Skip to main content

Table 6 Primers sequences used in this study

From: Transcriptional profiling of feline infectious peritonitis virus infection in CRFK cells and in PBMCs from FIP diagnosed cats

Target gene Accession number Sequence 5′ – 3′ Reference
GAPDH NM 001009307 F : AGTATGATTCCACCCACGGCA [36]
R : GATCTCGCTCCTGGAAGATGGT
YWHAZ EF458621 F: ACAAAGACAGCACGCTAATAATGC [37]
R: CTTCAGCTTCATCTCCTTGGGTAT
PD-1 EU295528 F: GAGAACGCCACCTTCGTC [19]
R: TGGGCTCTCATAGATCTGCGT
PD-L1 EU246348 F: CGATCACAGTGTCCAAGGACC [19]
R: TCCGCTTATAGTCAGCACCG
A3H EF173020 F: ACCCACAATGAATCCACTACAG This study
   R: AGGCAGTCTTTGTGAATTAGGG  
  1. F, forward primer, R, reverse primer.