Skip to main content

Table 6 Primers and probes used in this study*

From: Survey of causative agents for acute respiratory infections among patients in Khartoum- State, Sudan, 2010–2011

Primer Name Sequence (5′ to 3′) Target Gene Reference
  Primers for real time RT-PCR   
Set 1    
Inf A- F GACCRATCCTGTCACCTCTGAC M [15]
Inf A-R AGGGCATTYTGGACAAAKCGTCTA   
Inf A- probe TAMRA-TGCAGTCCTCGCTCACTGGGCACG-BHQ2   
InfB-F ATCGGATCCTCAACTCACTCTT NS [16]
InfB-R TGACCAAATTGGGATAAGACTC   
InfB-probe FAM-CTCGAATTGGCTTTGRATGTCCTTCAT-BHQ1   
FluC-F TGCATTAAAAGCGGATTCGTT NS this study
FluC-R GCTGGGCTCCTGATTTGATACT   
FluC-probe HEX-TGGCTACCGATGAAATCTCTCTCACTATACT-BHQ1   
RNase P-F AGATTTGGACCTGCGAGCG RNase P [15]
RNaseP-R GAGCGGCTGTCTCCACAAGT   
RNaseP-probe CY5-TTCTGACCTGAAGGCTCTGCGCG-BHQ3   
Set 2    
RSV-F GCCAAAAAATTGTTTCCACAATA L [16]
RSV-R TCTTCATCACCATACTTTTCTGTTA   
RSV- probe FAM-TCAGTAGTAGACCATGTGAATTCCCTGCA-BHQ1   
hMPV-F AACCGTGTACTAAGTGATGCACTC N [17]
hMPV-R CATTGTTTGACCGGCCCCATAA   
hMPV-Probe Cal Flour Orange560-CTTTGCCATACTCAATGAA CAAA CT-BHQ1   
Rhino-F TGGACAGGGTGTGAAGAGC 5′- UTR [18]
Rhino-R CAAAGTAGTCGGTCCCATCC   
Rhino-Probe TAMRA-TCCTCCGGCCCCTGAATG-BHQ2   
Adeno-F GCCCCAGTGGTCTTACATGCACATC H [16]
Adeno-R GCCACGGTGGGGTTTCTAAACTT   
Adeno-Probe Quasar670-TCGGAGTACCTGAGCCCGGGTCTGGTGCA-BHQ2   
Set 3    
SW InfA -F GCACGGTCAGCACTTATYCTRAG Np [15]
SW InfA-R GTGRGCTGGGTTTTCATTTGGTC   
SW InfA-Probe HEX-CYACTGCAAGCCCA“T”(BHQ1)ACACACAAGC AGGCA   
HA3-115-F GCTACTGAGCTGGTTCAGAGTTC H3 [19]
HA3-375-R GAAGTCTTCATTGATAAACTCCAG   
HA3-208-Probe FAM-CTATTGGGAGACCCTCATTGTGATGG-BHQ1   
  Primers for sequence   
H1-F AGCAAAAGCAGGGGAAAATAA H1 [20]
H1-R GCTATTTCTGGGGTGAATCT   
H3-F AGCAAAAGCAGGGGATAATTC H3 [20]
H3-R TGCCTGAAACCGTACCAACC   
Inf B-F AGCAGAAGCGTTGCATTTTC H3 [21]
Inf B-R ACCAGCAATAGCTCCGAAGA   
  1. *Abbreviations: M Matrix, NS Nonstructural, RNase P Ribonuclease P, L L protein, N nucleocapsid protein, Np nucleoprotein, UTR untranslated region, H hexon protein, H1 haemagglutinin subtype 1, H3 haemagglutinin subtype 3.
\