Skip to main content

Table 1 List of primers used for RT-qPCR in this study

From: Antiviral activity of carnosic acid against respiratory syncytial virus

Target RNA Sense (5′-3′) Anti-sense
hRSV A2 F CCACAATCCTCGCTGCAGTC GGCTCCTAGAGATGTGATAACGG
hRSV A2 NS2 ATTGGCATTAAGCCTACAAAGCA CTTGACTTTGCTAAGAGCCATCT
hRSV A2 SH AATTGGAAGCACACAGCTAC TTGCATTTGCCCCAATGTT
hRSV B G ATGATTGCAATACTAAA ACACTGGTATACCAACC
Influenza A NP TGTGTATGGACCTGCCGTAGC CCATCCACACCAGTTGACTCTTG
Influenza A M2/M1 CTTCTAACCGAGGTCGAAACGTA GGTGACAGGATTGGTCTTGTCTTTA
Interferon-β GAACTTTGACATCCCTGAGGAGATT TGCGGCGTCCTCCTTCT
Interferon-λ1 (IL-29) GGACGCCTTGGAAGAGTCAC AGCTGGGAGAGGATGTGGT
Interferon-λ2 (IL-28) AGGGCCAAAGATGCCTTAGA TCCAGAACCTTCAGCGTCAG
β-actin TGCCGCATCCTCTTCCTC CGCCTTCACCGTTCCAGT