Skip to main content

Table 1 Primers used for real-time PCR

From: The anti-HBV effect mediated by a novel recombinant eukaryotic expression vector for IFN-α

Gene Sequence (5′– > 3′) Size (bp)
GAPDH F:CATGGGTGGAATCATATTGGAA 155
R:GAAGGTGAAGGTCGGAGT
HBV-X F:CCGTCTGTGCCTTCTCATCTGC 256
R:ACCAATTTATGCCTACAGCCTCC
HBV-S F:ATCCTGCTGCTATGCCTCATCTT 314
R:ACAGTGGGGGAAAGCCCTACGAA
HBV-C F:CTGGGTGGGTGTTAATTTGG 186
R:TAAGCTGGAGGAGTGCGAAT
PKR F:ATGATGGAAAGCGAACAAGG 76
R:TTCTCTGGGCTTTTCTTCCA
RIG-I F:CTTCACATGGATTCCCCAG 187
R:GGCATGTTACACAGCTGACG
MDA-5 F:GGAGTTTTCAAGGATTTGAGC 479
R:AGTTTGGCAGAAGGAAGTGTC
LGP2 F:CCACAGCCACCATGCAGTTGAT 242
R:CAACTGAAGGTAGCCGGGA
TLR3 F:GACCTCTCCATTCCTGGC 156
R:TCACTTGCTCATTCTCCCTT