Figure 1

Schematic representation of alignment of a series of SPAT and partial cDNA clones derived from the dsRNAs of O. novo-ulmi isolate 93–1224. Contiguous sequences were initially collated by alignment of SPAT clones (black bars). The primers 5^′TGCAATTTGTTGCTAGTGGA3^′ and 5^′ACCTGCAACAAGTAACAATCTGG3^′ were used to make cDNA 1 and cDNA 2 according to SPAT 8 and the primer 5^′CTATATACAGTTAATATTAATTACAGGTAGATATGCTATGATATTTACAAATATCACTTATTAAACG3^′ was used to make cDNA 3 according to SPAT 10 (dashed lines). The linkages between contigs were determined by chromosome walking (indicated by lines with arrows) leading to a final assembly for dsRNAs 01–04. A single large ORF (white boxes) with the potential to encode RNA-dependent RNA Polymerases (RdRPs) was predicted for dsRNAs 01 and 02 while other smaller ORFs were detected in dsRNAs 03 and 04.