Skip to main content

Table 2 Oligonucleotide sequences of inverse PCR primers used to construct Myc PRMT6 and Tat-FLAG mutants

From: Overexpression of PRMT6 does not suppress HIV-1 Tat transactivation in cells naturally lacking PRMT6

Wild type Mutant Forward primera Reverse primera
Myc-PRMT6 ∆N acggtactggacgtggg cgaattcccgttgttcag
  ∆CD gcctccgccgagctcttc cttgcctcgcagtgctg
  ∆C1 cagcgctttgctcagcta cggcaggagaagaccgc
  ∆C2 gcgctcctctacctgaac tggacgagccagcacgt
  ∆C3 tgagaattcctgcagatatccag ctgtttccagtgagtggcc
Tat-FLAG ∆16 cagcctaaaactgcttgtacc catggtggcaagcttaagt
  ∆CC aggaagaagcggagacag agcagttttaggctgacttc
  ∆B cctcctcaaggcagtcagac gccataggagatgcctaagg
  ∆SE ggaggcgattataaggacga ttgctttgatagagaaactt
  EDE tcctagactagcgccctg gctactggcgccatgg
  CS tcttcctttcattcccaagtttct ctttttagaataggaattggtagaagca
  1. aSequences are written 5′ to 3′.