Skip to main content

Advertisement

Table 1 PCR primers and probes

From: No association between XMRV or related gammaretroviruses in Australian prostate cancer patients

Target Amplicon Size Method Primers and TaqMan Probe (5’-3’)
HuVAMP21 78 bp qPCR HuVAMP2-F CAGCATCTCTCCTACCCTTTCAC
HuVAMP2-R CCCCACACTTCTGGTTTTCTG
Huvamp2-Probe 6FAM-AGCAGGGATATCTAAGC-MGBNFQ2
BMLV3 76 bp qPCR BMLV-F GCCTGTCCAGGATCTGAGAG
BMLV-R GAGGTTGTAAGGGTTGGGCA
BMLV- Probe 5FAM-AAGTCAACAAGCGGGTGGAAGABHQ4
XMRVIN5 70 bp qPCR XMRVIN-F CGAGAGGCAGCCATGAAGG
XMRVIN-R GCGTATACGGGGTTGAGTCC
XMRVIN-Probe 6FAM-AGTTCTAGAAACCTCTACACTC-MGB
IAP6 71 bp qPCR MIAP-F GCCGCGCCCACATT
MIAP-R CGCAGATTATTTGTTTACCACTTAGAA
MIAP-Probe 6FAM-CCGTTACAAGATGGTGCTGA-MGBNFQ
RNASEL 137 bp PCR 462R-F GTGGAAAATGAGGAAGATGAATTTGCCAG
462Q-F GTGGAAAATGAGGAAGATGAATTTGCCAA
462-R ATTGGGGACTCACCTATTAAGATGTTTTG
  1. 1Human vesicle associated membrane protein 2.
  2. 2Minor group binding (MGB) non-fluorescent quencher.
  3. 3Primers can detect both XMRV and MLV sequences.
  4. 4Black hole quencher.
  5. 5Primers/probe specifically detect conserved integrase sequences.
  6. 6Mouse intracisternal-A particl.