Skip to main content

Table 3 Real-time polymerase chain reaction primers, gene targets and the corresponding Arabidopsis thaliana homologs

From: A remarkable synergistic effect at the transcriptomic level in peach fruits doubly infected by prunus necrotic ringspot virus and peach latent mosaic viroid

Protein Locus name (Peach) Arabidopsis thaliana homolog % Homology Forward primer (5´-3´) Reverse primer (5´-3´)
Elongation factor 1-alpha (EF1-a) ppa005718m.g At5g60390 95.3 CCTTTGTCCCCATTTCTGGAT CCTTTGTCCCCATTTCTGGAT
Clathrin adapter complex (CAC) ppa005912m.g At5g46630 90.9 CAAAATTCCTGTGCCAAAACAA GCTCGACCCGAAGTCACTTG
Phytoene synthas ppa005962m.g At5g17230 81.5 TGGGCCTAACGCCTCACA TCTTCTAACCTCGACTCCCACCTA
Auxine response protein (IAA9) ppa007194m.g At5g65670 71.3 TGATTCATGCAAGAGGTTGAAGA GCCCTAGGAGCTAAGCCAATG
Glutamate descarboxilase ppa004796m.g At5g17330 89.0 TGAAGGCTGCCGATGGA TACTCTCAAGTGCCCTCGTCTCT
Cysteine proteinase ppa004796m.g At1g47128 80.3 CAACCATGGCGATTCTTTTTC ATTGACATGTCCACGGCTGAT
Invertase/pectin methylesterase inhibitor family ppa011831m.g At5g62350 64.4 CCTGCCTTATGTGTCCACTCACT AAACGTTTAGGGCTTGTTTGGAT
Glutamate deshydrogenase ppa006458m.g At5g07440 95.4 TCGATTCAGGGTTTGACATTTGT GCTTCGCAGCCCATGTTC
Universal Stress Protein ppa012560m.g At3g53990 85.6 TCGGAATCGCCATGGATTT CTCGATCGCCCATTTCAGA
CBL-interacting protein Kinase 6 ppa006023m.g At4g30960 85.7 GCTTCACGGCCGTTACGAT GTGGTACACCTTCGCGAATGT