Skip to main content

Table 4 Sequence details of all primer-probe combinations

From: Epidemiological analysis of respiratory viral etiology for influenza-like illness during 2010 in Zhuhai, China

Virus type Target Amplicon Oligonuleotide sequence(5′-3′) Nucleotide positions GenBank accession no.
   length(bp) Forward   
    Reverse   
    Probe   
Parainfluenza 1 HN gene 109 GTTGTCAATGTCTTAATTCGTATCAATAATT 1191–1220 U70948
    GTAGCCTACCTTCGGCACCTAA 1278–1299  
    TTGGAATAGTCTCGACAACAATCTTTGGCCTA 1232–1263  
Parainfluenza 2 HN gene 90 GCATTTCCAATCTTCAGGACTATGA 767–791 D00865
    ACCTCCTGGTATAGCAGTGACTGAAC 831–856  
    CCATTTACCTAAGTGATGGAATCAATCGCAAA 795–826  
Parainfluenza 3 HN gene 136 AGTCATGTTCTCTAGCACTCCTAAATACA 779–807 L25350
    ATTGAGCCATCATAATTGACAATATCAA 887–914  
    AACTCCCAAAGTTGATGAAAGATCAGATTATGCA 828–861  
Respiratory syncytial virus F gene 90 AACAGATGTAAGCAGCTCCGTTATC 789-813 AF067125
    CGATTTTTATTGGATGCTGTACATTT 853–878  
    TGCCATAGCATGACACAATGGCTCCT 822-847  
Human metapneumovirus N gene 163 CATATAAGCATGCTATATTAAAAGAGTCTC 89-116 AB503857
    CCTATTTCTGCAGCATATTTGTAATCAG 224–251  
    TGCAATGATGAGGGTGTCACTGCGGTTG 149-176  
    TGTAATGATGAGGGTGTCACTGCGGTTG   
Adenoviru A Hexon gene 135 GGTCTGGTGCAATTCGCC 17818–17835 X73487
    CACGGGCACAAAACGCA 17936–17952  
    CCACGGACACCTACTTCACCCTGGG 17840–17864  
Adenoviru B Hexon gene 138 CGCCGGACAGGATGCTT 45–61 X76549
    CTACGGTCGGTGGTCAC 166–182  
    AGTCCGGGTCTGGTGCAGTTCGCC 73–96  
Adenoviru C Hexon gene 143 ACCTGGGCCAAAACCTTCTC 2884–2903 J01966
    CGTCCATGGGATCCACCTC 2940–2958  
    AACTCCGCCCACGCGCTAGA 2910–2929  
Adenoviru D VA gene 75 AAAAACGAAAGCGGTTGAGC 2–21 U10675
    CGGGTCGAGACGGGAGT 128–144  
    CCAATACCACGTTAGTCGCGGCT 104–126  
Adenoviru E Hexon gene 113 CAACACCTACTCGTACAAAGTGCG 225–248 X84646
    TAGGTGCTGGCCATGTCCA 281–299  
    CGCCCACGGCCAGCGTGT 251–268  
Adenoviru F 1.5 χ-2 gene   CCCGTGTTTGACAACGAAGG 31277–31296 L19443
    TTAGAGCTAGGCATAAATTCTACAGCA 31363–31389  
    ATCGACAAGGACAGTCTGCCAACACTAACG 31326–31355