Skip to main content

Table 1 Palindromic sequences in the region surrounding the cleavage site insert provide insights to possible RNA recombination events

From: The highly pathogenic H7N3 avian influenza strain from July 2012 in Mexico acquired an extended cleavage site through recombination with host 28S rRNA

Strain (Origin) Sequence
(Chicken 28S rRNA) TGGTTCGATTAGTCTTT CGCCCCTATACCCGGGTCGGACGACCGATTTGCACGTCAGGACCGCT ACG
A/turkey/Oregon/71 TCCAAAGACT AGTCTTTCGCCCCTATACCCGGGTCGGACGACCGATTTGCACGTCAGGACCGCT AGA
A/Seal/Mass/1/80 (NP) AGAGGAGAAACAAATATCTGGAAGAGCATCCCAGTG CTGGGA AAGATCCTAAGAAGACAGGGGGTCCAATCTACAGGAGGA GAG
A/Seal/Mass/1/80 ATGTCCCAG AGAATCCAAAGAAAGAGCATCCCAGTGCTGGGAAAGATCCTAAGAAGACAGGGGGTCCAATCTACAGGAGGA CCA
A/chicken/Chile/184240-1/2002 (NP) TCAGCAGGACAGATAAGCGTGCAGCCCAC TTTCT CGGTGCAGAGAAACC TTC
A/chicken/Chile/184240-1/2002 TCCAGAAA AACCAAAGACATGCAGCCCACTTTCTCGGTGCAGAGAAACC AGA
A/chicken/BC/CN7/2004 (M1) ATAATCTTCTTGAAAATTTGCAGGCCTACCAGAAACGAA TG GGA GTG
A/chicken/BC/CN7/2004 ACGTCCCA GAGAACCCCAAGCAGGCCTACCGGAAACGAATG ACCAGA
(Chicken 28S rRNA) CTTGGTGAATTCTGCTTCACAATGATAGGAAGAGCCGACATCGAAGGA TCAAAAAGCGACGT CGC
A/chicken/Jalisco/CPA1/2012 GAAACGTC CCAGAGAACCCCAAGGATAGGAAGAGCCGACATCGAAGGA CCAGAGGCCTTTTTGGA
  1. Representative H7 strains with known or predicted insert origin are presented in the table. The inserts (underlined) and 25 bases flanking the insert were examined for palindromic sequences together with the gene containing the putative insert origin. Data is presented as double row pairs where the top row represents the putative insert origin while the lower row represents the HA sequence with the observed insert. Palindromic sequences are represented in bold and italics.
\