Skip to main content

Advertisement

Table 2 Sequences of porcine-specific real-time RT-PCR primers and TaqMan probes

From: Comparative expression of Toll-like receptors and inflammatory cytokines in pigs infected with different virulent porcine reproductive and respiratory syndrome virus isolates

Genesa Primer sequence (5’-3’)b Probe sequence (5’-3’)c Accession numberd
TLR2 F:TGCTGGAACCCATCGAGAA AAGGCCATTCCCCAGCGTTTCTGTAA GU138028
R:AGGTAGGTCCTGGTGTTCATTATCTT
TLR3 F:CCCAGTGATTCTTTTTGATACATCA CCTGCAAAGACAGTGCCCCATTTGA GU013759
R:CATACTGGCACTTATCATGAAAAAGAG
TLR7 F:CCAACAACCGGCTTGATTTAC CAACAGCATTCGAAGAGCTACGCAACC GU013760
R:TCTGATTGAAAATAGTGGCTGTTACTACT
TLR8 F: AAAAAGCACGTCCCTGAAAGAA TTTTCAGTGGAAACCGCCTGGACCTT GU013761
R:TACCTGTCATCTTGGGCATTCC
β-actin F:TCTTCCAGCCCTCCTTCCT AGTCCTGCGGCATCCACGAGACC U07786
R:ACGTCGCACTTCATGATCGA
18S rRNA F:CCCCAACTTCTTAGAGGGACAA TGGCGTTCAGCCACCCGAGATTT DQ437859
R:GGGCATCACAGACCTGTTATTG
  1. aTLR2, Toll-like receptor 2; TLR3, Toll-like receptor 3; TLR7, Toll-like receptor 7; TLR8, Toll-like receptor 8; 18S rRNA, 18S ribosomal RNA.
  2. bF, forward primer; R, reverse primer.
  3. cAll probes contained FAM as a fluorescent reporter dye at 5’end and TAMRA as quencher dye at the 3’end.