Skip to main content

Table 1 Alignment of the 0.3-kb fragment sequences among the gamma retroviruses

From: The 0.3-kb fragment containing the R-U5-5’leader sequence of Friend murine leukemia virus influences the level of protein expression from spliced mRNA

Name Accession no. 1st, 2nd, 3rd, 4th nucleotide 5th nucleotide 6th nucleotide 7th nucelotide
Murine leukemia virus
Exogenous ecotropic
  Friend clone A8 D88386 CCCGTGTATCCAATAAATCCTCTT CGACTTGTGGT GGATCCGGAGA GCCCAGGGACC
  Friend clone 57 X02794 *****A*TC********G****** *****C***** *****T***** *****A*****
  Friend FB29 NC_001362 ************************ *****C***** *****T***** ***********
  Friend PVC211 M93134 ************************ *********** *********** ***********
  Moloney NC_001501 *****************C****** *********** *****G***** ***********
  Moloney ts1-92b AF462057 *****************C****** ***A*C***** ****TT***** ***********
  Cas-Br-E X57540 *****************C****** *****G***** ********G** *******A***
  SRS19-6 AF019230 *******T*********G****** *********** *********** ***********
  SL3-3 AF169256 *****************G***T** ***A*C***** *****T***** ***********
  RadLV K03363 *****************G***T** ***A*C***** ****TT***** ***********
  Rauscher NC_001819 ************************ *********** *****T***** ***********
  Graffi GV-1.2 AB187565 *****TCC*--******G****** ***A*C****A *********** ***********
Amphotropic
  1313 AF411814 *****************C****** ****GA***** ****TT***** ***********
Xenotropic
  DG-75 AF221065 *******TC********G****** ***A*C***** A***TA***** ***********
  NZB-9-1 K02730 *******TC********G***T** ***A*C***** *********** ***********
Endogenous ecotoropic
  AKV J01998 *****************G***T** ***A*C***** ****TT***** ***********
  pSR3 M87550 *****************G***T** ***A*C***** *****T***** ***********
  BM5eco AY252102 *****************G***T** ***A*C***** ****TT***** ***********
Polytropic
  MCF1233 U13766 *******TC********G***T** ***AAC****C ****TT***** ***********
Unclassified
  Abelson NC_001499 *****************C****** *********** *****G***** ***********
Feline leukemia virus NC_001940 ********CG-******C*-**** T****C***** *****GA**CC C***C******
Gibbon ape leukemia virus NC_001885 *******G*********A****** G**GCC***** *****G*A*AC C*--*******
  1. Alignment of sequences around the 1st to 7th nucleotides (underlined). Asterisks represent sequence identities.