Skip to main content

Advertisement

Table 4 Description of the primer pairs

From: Phylogenetic analysis of the haemagglutinin gene of canine distemper virus strains detected from giant panda and raccoon dogs in China

Primer pair Sequence 5’–3’ Target Sense Purpose Amplicon size (bp)
A CGGAAATCAACGGACCTAAAT N + Diagnostic 242
  TCCTTGAGCTTTCGACCCTT   _   
B TGGTTCACAAGATGGTATTC H + Phylogenetic 613
  CAACACCAC TAAATTGGACT   _