Skip to main content

Advertisement

Table 2 Primer and Probe Sequences

From: Persistent expression of chemokine and chemokine receptor RNAs at primary and latent sites of herpes simplex virus 1 infection

  Forward Primer Reverse Primer Probe*
HSV    
tk CGAGACAATCGCGAACATCTAC CCCCGGCCGATATCTCA CCACACAACACCGCCTCGACCA
ICP0 CTGCGCTGCGACACCTT CAATTGCATCCAGGTTTTCATG TGCATGCACCGCTTCTGCATCC
Chemokine receptor    
CCR1 GGGTGAACGGTTCTGGAAGTAC CAGCCATTTTGCCAGTGGTA ACATGCCTTTGAAACAGCTGCCGAA
CCR2 ATGAGTAACTGTGTGATTGACAAGCA GCAGCAGTGTGTCATTCCAAGA CTCTGTCACCTGCATGGCCTGGTCT
CCR3 ACCAGCTGTGAGCAGAGTAAACAT CACAGCAGTGGGTGTAGGCA CACCTCAGTCACCTGCATGGCCA
CCR5 ACTGCTGCCTAAACCCTGTCA GTTTTCGGAAGAACACTGAGAGATAA TCCGGAACTTCTCTCCAACAAAGGCA
CCR6 TTGGTGCAGGCCCAGAAC GAACACGAGAACCACAGCGAT CCAAGAGGCACAGAGCCATCCGA
CCR7 CTGCTACCTCATTATCATCCGTACCT TGATCACCTTGATGGCCTTGT CTCCAGGCACGCAACTTTGAGCG
CXCR3 TGTAGTTGGGCTAGCTCGAACTT ACCTGGATATATGCTGAGCTGTCA GCATCCTGGCAGCAAAGTTACGGG
CXCR4 CTCCAAGGGCCACCAGAA GGCAAAGAAAGCTAGGATGAGG CGCAAGGCCCTCAAGACGACAGTC
Chemokine    
MIP-1α TCATCGTTGACTATTTTGAAACCAG GCCGGTTTCTCTTAGTCAGGAA AGCCTTTGCTCCCAGCCAGGTGTC
MIP-1β AGGGTTCTCAGCACCAATGG GCTGCCGGGAGGTGTAAGA CTCTGACCCTCCCACTTCCTGCTGTTT
RANTES CTGTCATCGCTTGCTCTAGTCCTA CGGATGGAGATGCCGATTT ATCCCCTACTCCCACTCCGGTCCTG
MCP-1 GCTGGGTTCAGTTTCCTTAAGC CCTAGTCTTTAGCTGTGAGACCTTCTG AGGCCTCGCTGCTCCACATCCA
Eotaxin-1 CCTAAGACGTGCTCTGAGGGAAT TCCCATCTGGAACTACATGAAGC TCAGCACCAGTCGCCCAAGGACT
Cytokine    
IFN-γ TGAGTATTGCCAAGTTTGAGGTCA GTGGACCACTCGGATGAGCT CCACAGGTCCAGCGCCAAGCA
TNF-α ACAAGGCTGCCCCGACTAC CGCAGAGAGGAGGTTGACTT CCTCACCCACACCGTCAGCCG
  1. * all probes FAM-5' and 3'-TAMRA