Open Access

Genomic organization and recombination analysis of a porcine sapovirus identified from a piglet with diarrhea in China

Virology Journal201714:57

DOI: 10.1186/s12985-017-0729-1

Received: 7 September 2016

Accepted: 9 March 2017

Published: 16 March 2017

Abstract

Background

Sapovirus (SaV), a member of the family Caliciviridae, is an etiologic agent of gastroenteritis in humans and pigs. To date, both intra- and inter-genogroup recombinant strains have been reported in many countries except for China. Here, we report an intra-genogroup recombination of porcine SaV identified from a piglet with diarrhea of China.

Methods

A fecal sample from a 15-day-old piglet with diarrhea was collected from Shanghai, China. Common agents of gastroenteritis including porcine circovirus type 2, porcine rotavirus, porcine transmissible gastroenteritis virus, porcine SaV, porcine norovirus, and porcine epidemic diarrhea virus were detected by RT-PCR or PCR method. The complete genome of porcine SaV was then determined by RT-PCR method.

Phylogenetic analyses based on the structural region and nonstructural (NS) region were carried out to group this SaV strain, and it was divided into different genotypes based on these two regions. Recombination analysis based on the genomic sequence was further performed to confirm this recombinant event and locate the breakpoint.

Results

All of the agents showed negative results except for SaV. Analysis of the complete genome sequence showed that this strain was 7387 nt long with two ORFs and belonged to SaV GIII. Phylogenetic analyses of the structural region (complete VP1 nucleotide sequences) grouped this strain into GIII-3, whereas of the nonstructural region (RdRp nucleotide sequences) grouped this strain into GIII-2. Recombination analysis based on the genomic sequence confirmed this recombinant event and identified two parental strains that were JJ259 (KT922089, GIII-2) and CH430 (KF204570, GIII-3). The breakpoint located at position 5139 nt of the genome (RdRp-capsid junction region). Etiologic analysis showed the fecal sample was negative with the common agents of gastroenteritis, except for porcine SaV, which suggested that this recombinant strain might lead to this piglet diarrhea.

Conclusions

P2 strain was an intra-genogroup recombinant porcine SaV. To the best of our knowledge, this study would be the first report that intra-genogroup recombination of porcine SaV infection was identified in pig herd in China.

Keywords

Porcine sapovirus Genome organization Recombination

Background

Sapovirus (SaV) is the causative agent of gastroenteritis and has been detected in multiple mammalian species and pigs are the predominant host of SaV [13]. Based on the complete capsid protein VP1 sequences, SaV now has been divided into 15 genogroups (GI-GXV) and GIII was the predominant one infecting pigs [4]. GIII strains have been further clustered into several genotypes based on the partial VP1 or RNA-dependent RNA polymerase (RdRp) sequences reported by different researchers [5, 6]. Genomic organization of a common SaV includes two open reading frames (ORF1 and ORF2), whereas in certain genogroups strains were identified an additional ORF (ORF3) [79]. ORF1 encodes the predicted viral NS proteins and the major capsid protein VP1, ORF2 encodes the minor capsid protein VP2, and ORF 3 encodes a small basic protein with unknown function [9].

SaV strains with inconsistent grouping between the nonstructural protein-encoding region (including the RdRp region) and the VP1 encoding region have been designated as “recombinant”. Previous studies suggested that the recombination site was at the polymerase-capsid junction [1, 2]. To date, both intra- and inter-genogroup recombinant strains have been reported in humans, however, few porcine recombinant SaV strains have been reported all over the world [1013]. In particular, no recombinant strain of SaV has been identified either in human or pig in China.

In the present study, we characterized the complete genome of a porcine SaV which might lead to a piglet diarrhea and analyzed the recombination of this strain. Phylogenetic and recombination analysis showed that this strain was an intra-genogroup recombinant, and the breakpoint for this recombination event located at the polymerase-capsid junction within ORF1. This is the first report that intra-genogroup recombination of porcine SaV related with a piglet diarrhea in China.

Methods

Specimens

A fecal sample from a 15-day-old piglet with diarrhea was collected in October, 2015 in Shanghai, China. Bacterial infection was ruled out by the diagnosis of the licensed veterinarian from the pig farm. In order to avoid sample contamination, specimen was obtained directly from the pig anus and disposable materials were used during sampling. Stool sample was freshly collected and immediately converted to 10% (w/v) suspension in phosphate-buffered saline (PBS, 0.01 M, pH 7.2-7.4) for further RNA and DNA extraction.

RNA and DNA extraction

Viral RNA/DNA was extracted from 200 μl of fecal supernatant by using the TaKaRa MinBEST Viral RNA/DNA Extraction Kit version 5.0 (TaKaRa, Japan), according to the manual instruction. RNA/DNA was dissolved in 25 μl RNase-free water and reverse transcription was performed immediately.

RT-PCR or PCR

Polymerase chain reaction (PCR) or reverse transcription polymerase chain reaction (RT-PCR) assays with certain primer sets for the detection of porcine common viruses that may cause pig diarrhea including porcine circovirus type 2 (PCV2), porcine rotavirus (PRV), porcine transmissible gastroenteritis virus (PTGV), porcine SaV, porcine norovirus (NoV), and porcine epidemic diarrhea virus (PEDV) were performed as previously described [1416].

Whole genome amplification

To amplify the genome of this SaV strain, the first strand cDNA was synthetized in 20 μl reaction mixture followed the Thermo Scientific RevertAid First Strand cDNA Synthesis Kit’s (Thermo, USA) introductions with 1 μl random hexamer primer supplied by the kit for the full sequences amplification or 1 μl gene-specific primer QT (Table 1) especially for the 3’ end amplification (3’ RACE method), respectively [17]. Eleven sets of specific primers were designed based on KF204570 to amplify the remaining sequences (Table 1). All the PCR products were purified by OMEGA Gel Kit (OMEGA, USA) following the manufacturer’s instructions, ligated to the pMD19-T vector (TaKaRa, Japan) and then transformed into DH5α competent Escherichia coli cells (Yeasen, China). For each product, three to five colonies were selected and sequenced (Sangon, China) in both directions with the M13+/- universal primers. The consensus sequences were assembled using the Lasergene Software package (version 8) (DNASTAR Inc., Madison, WI).
Table 1

Primers for amplifying the complete genome

Primer name

Primer sequence (5’-3’)

Position

References

SAVP1F

GTGATCGTGATGGCTAATTGC

1-21

JX678943

SAVP1R

GAACTGTTTCAACACTGT

622-639

JX678943

SAVP2F

GGGACATGTGGCAGTAC

533-549

JX678943

SAVP2R

TTGAAGTAGTCCACTATCCACAT

1087-1109

JX678943

SAVP3F

ACTGACAAGTTTGCTGA

862-878

JX678943

SAVP3R

GTGTGGGGCAATTGGTGGT

1660-1678

JX678943

SAV4FW

TTGAATTGTGACCGGCCAGAG

1600-1620

KX688107

SAVP5R

TCATCATACTCATCGTCCCT

2863-2882

JX678943

SAVP6F

CTGAACACCCGTGA

2782-2795

JX678943

SAVP9R

AGCACAGCCATGGCAAAG

4551-4568

JX678943

SAVP10F

CCATAGCCACACTGTGTTCAC

4427-4447

JX678943

SAVP10R

TCTTCATCTTCATTGGTGGGAG

5102-5123

JX678943

SAVP11F

CCAAGGGCAGTGTTTGAC

4963-4980

JX678943

SAVP11R

GGTTGGTACACATAAAGTGCC

5676-5696

JX678943

SAVP12F

GATGTTAGGGCGGTGGA

5620-5636

JX678943

SAVP12R

AGGTGAAAGTGGTGTCTTCTG

6674-6694

JX678943

SAVP13F

CTCGGCACGCACACGGG

6469-6485

JX678943

SAVP13R

TGATTGGCAGGTAAATTTG

6961-6979

JX678943

SAV14N

GATGGAGTTGGCTAAAGAACA

6893-6913

KX688107

QT

CCAGTGAGCAGAGTGACGAGGACTCGAGCTCAAGCTTTTTTTTTTTTTTTTT

 

[17]

QO

CCAGTGAGCAGAGTGACG

 

[17]

QI

GAGGACTCGAGCTCAAGC

 

[17]

Sequence and recombination analysis

Similarity searches of the sequences were carried out in BLAST (http://www.ncbi.nlm.nih.gov/BLAST/). After a multiple alignment with CLUSTAL W embedded in MEGA 7, the phylogenetic relationship of the strain in the present study and the reference sequences were assessed using MEGA 7. For analysis in MEGA 7, Jukes-cantor (JC) distance was utilized, employing the Neighbor joining (NJ) algorithm [18]. The reliability of different phylogenetic groupings was evaluated by using the bootstrap test (1000 bootstrap replications) available in MEGA 7. The identification of recombinants was performed by using the Recombination Detection Program 4 (RDP 4) (http://darwin.uvigo.es/rdp/rdp.html) [19]. Prototype SaV strains used as references in the analysis with their corresponding GenBank accession numbers, source of origin and genogroups are showed in Table 2.
Table 2

Profile of porcine sapovirus isolates used for sequence analyses

Strain ID

GenBank accession number

Length

Geographic origin

Genogroup

VZ

DQ056363

1940 bp

Venezuela

GIII

YiY1/2006

EU381231

1635 bp

China b

GIII

OH-MM280/2003

AY823308

2971 bp

USA

GIII

NC-QW270

AY826426

2971 bp

USA

GIII

S20

AB242875

1635 bp

Japan

GIII

HW20/2007

HM346629

2983 bp

South Korea

GIII

DG24/2007

HM346628

3016 bp

South Korea

GIII

ah-1/2009

JX678943

7342 bp

China b

GIII

Cowden

AF182760

7320 bp

USA

GIII

LL14

AY425671

7291 bp

USA

GIII

JJ259

KT922089

7347 bp

USA

GIII

sav1/2008

FJ387164

7558 bp

China b

GIII

CH430/2012

KF204570

7371 bp

China b

GIII

p2a

KX688107

7371 bp

China b

GIII

WG194D-1

KX000383

7496 bp

USA

GV

TYMPo239

AB521771

3949 bp

Japan

GV

TYMPo31

AB521772

3949 bp

Japan

GV

OH-JJ674

KJ508818

7198 bp

USA

GVI

OH-JJ681

AY974192

7198 bp

USA

GVI

RV0042/2011

KX000384

7150 bp

USA

GVII

OH-LL26/2002

AY974195

2952 bp

USA

GVII

K7

AB221130

7144 bp

Japan

GVII

K10

AB221131

2972 bp

Japan

GVII

AB23

FJ498787

3000 bp

Canada

GVII

DO19/2007

HM346630

2983 bp

South Korea

GVII

2014P2

DQ359099

1626 bp

Brazil

GVII

F2-4/2006

GU230161

2935 bp

Canada

GVII

F8-9/2006

GU230162

2926 bp

Canada

GVII

WGP3/2009

KC309420

2933 bp

USA

GVII

WGP247/2009

KC309421

6052 bp

USA

GVII

WG194D/2009

KC309416

6654 bp

USA

GVIII

WG214D/2009

KC309419

7497 bp

USA

GVIII

06-18p3

EU221477

3094 bp

Italy

GVIII

F19-10

FJ498786

3142 bp

Canda

GVIII

WG180B

KC309415

3111 bp

USA

GVIII

WG197C/2009

KC309417

6497 bp

USA

GVIII

WG214C

KC309418

3695 bp

USA

GIX

F16-7

FJ498788

2982 bp

Canada

GIX

K8

AB242873

1617 bp

Japan

GX

2053P4

DQ359100

1635 bp

Brazil

GXI

aThe strain with complete genomic sequence determined in this study

bThe strains which were deposited in GenBank database by Chinese researchers and used in this study were bolded

Results

Result of viruses detection

RT-PCR or PCR were performed to detect the common viruses that may cause pig diarrhea. Result showed that the fecal sample was negative for porcine NoV, PCV 2, PRV, PTGV and PEDV, but was positive for porcine SaV.

Genome organization

The whole genome of p2 strain was determined by RT-PCR and 3’ RACE method. The entire genome of this porcine SaV strain (named as p2, GenBank no. KX688107) consisted of 7387 nucleotides (nt) including the poly (A) tail with a 9 nt 5’ untranslated region (UTR) and a 54 nt 3’-UTR. Similar to previously reported porcine strains, p2 has two ORFs. ORF1 comprised 6,765 nt (10-6774) encoding a single polyprotein of 2,254 amino acid (aa). ORF2 comprised 516 nt (6771–7286) and contained a 4-nt overlapping region (6771ATGA6774) with the 3′ end of ORF1 (Fig. 1).
Fig. 1

Schematic of strain p2 genome organization. The full genome of strain p2 is a linear, positive-sense,single-stranded RNA of 7387 bp with a poly (A) tail at the 3’ end. The nucleotides coordinate of 5’ UTR, ORF 1 and ORF 2, and 3’ UTR are indicated on the map. ORF1 encoded a single polyprotein which was subsequently cleaved into seven nonstructural proteins containing the RdRp region and the major capsid protein VP1. ORF2 encoded the minor capsid protein VP2 (171 aa)

Phylogenetic and recombination analysis

P2 shared the highest nucleotide homology (91%) through the entire genome and about 94% in the capsid region with CH430 (GIII-3, GenBank no. KF204570) (a Chinese porcine SaV strain), respectively. However, it shared only 87% identity with strain CH430 in the RdRp region. On the contrary, p2 shared the highest 91% nucleotide identity with an American strain JJ259 (GIII-2, GenBank no. KT922089) in the RdRp region, which was opposite to the general phenomenon observed for caliciviruses that the RdRp region is more conserved than the capsid region. In the previous studies, SaV strains with inconsistent grouping between the nonstructural protein-encoding region (including the RdRp region) and the VP1 encoding region were designated as recombinant. All of these suggested that p2 strain may be a recombinant virus.

Phylogenetic and recombination analysis were further performed to verify the genotype definition and recombination. Phylogenetic tree based on 42 of the complete VP1 nucleotide sequences was constructed by the NJ method, in which p2 was grouped into GIII-3 clustering with CH430 (Fig. 2). However, phylogenetic analysis based on the 3’ end of RdRp nucleotide sequences gave a different grouping result, in which p2 was grouped into the GIII-2 clustering with JJ259 (Fig. 3). This finding suggested that this strain may be an intra-genogroup recombinant within GIII. To confirm the finding and detect the breakpoint where the recombination event occurred, we performed recombination analysis with p2 as the query sequence, JJ259 and CH430 as the background sequences and OH-MM280 (GIII-1, GenBank no. AY823308) as the outlier sequence using RPD software. Recombination analysis confirmed that the p2 strain was a recombinant and the major and minor parent was JJ259 and CH430, respectively. Moreover, the breakpoint for this recombination event located at position 5139 nt of the genome, which was the polymerase-capsid junction within ORF1 (Fig. 4).
Fig. 2

Phylogenetic tree based on the complete VP1 nucleotide sequences of 42 SaV strains using MEGA 7. These strains represented all reported 8 genogroups (GIII, GV-GXI) of porcine SaV. GIII strains were grouped into 5 genotypes (GIII-1 – GIII-5). Among those strains, the p2 strain determined in this study was marked with box. Each SaV strain is presented as the following format: strain ID- GenBank accession number

Fig. 3

Phylogenetic tree of the 3’ end of RdRp nucleotide sequences (780 bp) of SaV strains. Only 25 of 42 strains had the available sequences of 3’ end of the RdRp region covering the RdRp-capsid junction and GIII strains were grouped into 5 genotypes (GIII-1-GIII-5). The strain p2 reported in this study was indicated in box

Fig. 4

Identification of recombinant p2 strain based on RDP 4. BOOTSCAN evidence for the recombination origin on the basis of pairwise distance, modeled with a window size 200, step size 25, and 100 Bootstrap replicates

Discussion

SaV causes acute gastroenteritis in humans and animals including pigs, mink, dogs, sea lions, and bats [4, 9, 20]. Porcine SaV and human strains were separated into a different genogroups, however, based on analyses of RdRp or capsid protein genes, porcine SaV that genetically resembled human strains rather than previously recognized porcine strains had been identified [21, 22]. These findings suggested the possibility of a pig reservoir for human strains or vice versa. Meanwhile, recombination as an important survival event for all living creatures, may result in generation of new viruses with unknown pathogenic potential and altered species tropism for both animals and humans [23]. To date, both intra- and inter-genogroup recombinant strains have been reported [1113, 2224]. So far the recombinant strain was not found in either human beings or animals of China, although the SaV infections in children and pigs were common in this area [2527]. Here, we reported a complete genome of a recombinant SaV strain that identified from a piglet with diarrhea in China. Phylogenetic and recombination analysis based on the genomic sequences showed that p2 was an intra-genogroup recombinant within GIII, and the breakpoint located in the RdRp-capsid junction region, which was consistent with most of other SaV recombination events. Previous reports had shown that, in the genome of SaV, recombination mostly occurred at the polymerase-capsid junction region within ORF 1 which was referred as ‘hot spot’ [2, 13]. Chang et al. detected a 2.2 kb RNA in vitro replication assay with the replication complex of SaV Cowden strain extracted from virus-infected cells suggesting that SaV will generate subgenomic RNA during virus replication [8]. Moreover, researchers found that the RdRp-capsid junction region of SaV contained a highly conserved ~20 nucleotide (nt) motif in both genomic and subgenomic RNA molecules which was considered as a transcription start signal [2]. This conserved nucleotide motif may facilitate homologous recombination during co-infection of a cell by different genogroups of virus.

SaV has been detected in a wide range of mammals with potential ability of zoonotic transmission [2831]. Recombination was considered as a force of evolution which may produce new virus with potentially different pathogenesis and virulence [32]. Moreover, an infectious NoV chimera comprising the distinct biological properties from the parental viruses has been constructed and is infectious in vivo [32, 33]. Therefore, detection and understanding the recombination of SaV is important. In the current study, p2 strain was identified from a pig with diarrhea, in which bacteria and the common enteric viruses that cause pig gastroenteritis were ruled out. This suggested that this recombinant virus may cause this piglet diarrhea under the nature condition. More researches such as experimental infection should be performed in the future to confirm the pathogenicity of this recombinant strain.

Conclusions

This is the first report that an intra-genogroup recombinant porcine SaV infected piglet in China and may lead to the piglet diarrhea. This finding raised our awareness of whether recombination in SaV will increase its virulence.

Abbreviations

aa: 

Amino acid

GIII: 

Genogroup III

JC: 

Jukes-cantor

NJ: 

Neighbor joining

NoV: 

Norovirus

nt: 

Nucleotides

ORF: 

Open reading frame

PCR: 

Polymerase chain reaction

PCV2: 

Porcine circovirus type 2

PEDV: 

Porcine epidemic diarrhea virus

PRV: 

Porcine rotavirus

PTGV: 

Porcine transmissible gastroenteritis virus

RdRp: 

RNA-dependent RNA polymerase

RT-PCR: 

Reverse transcription polymerase chain reaction

SaV: 

Sapovirus

UTR: 

Untranslated region.

Declarations

Funding

This study was funded by the National Natural Science Fund of China (Grant No.31270186, 31572525 and 31402211); The Natural Science Foundation of Jiangsu Province (No. BK20140578), China Postdoctoral Science Foundation (No. 2013 M530234; The Ph.D Programs Foundation of the Ministry of Education of China (No. 20133227120010); Jiangsu Planned Projects for Postdoctoral Research Funds, (No. 1301142C).

Availability of data and materials

All the data supporting the results are included in the article.

Authors' contributions

XGH, QS and JJL conceived the study and designed the experiments. JJL and QS performed the laboratory assays, analyzed the data and drafted the manuscript. All authors read and approved the final manuscript.

Competing interests

The authors declare that they have no competing interests.

Ethics approval and consent to participate

Not applicable.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
School of Agriculture and Biology, Shanghai Jiao Tong University
(2)
School of Medicine, Jiangsu University
(3)
Shanghai Entry-Exit Inspection and Quarantine Bureau
(4)
Shanghai Pudong New Area Center for Animal Disease Control and Prevention
(5)
Shanghai Pudong New Area Center for Agriculture Service

References

  1. Hansman GS, Oka T, Katayama K, Takeda N. Human sapoviruses: genetic diversity, recombination, and classification. Rev Med Virol. 2007;17(2):133–41.View ArticlePubMedGoogle Scholar
  2. Oka T, Wang Q, Katayama K, Saif LJ. Comprehensive review of human sapoviruses. Clin Microbiol Rev. 2015;28(1):32–53.View ArticlePubMedPubMed CentralGoogle Scholar
  3. Ren Z, Kong Y, Wang J, Wang Q, Huang A, Xu H. Etiological study of enteric viruses and the genetic diversity of norovirus, sapovirus, adenovirus, and astrovirus in children with diarrhea in Chongqing, China. BMC Infect Dis. 2013;13:412.View ArticlePubMedPubMed CentralGoogle Scholar
  4. Oka T, Lu Z, Phan T, Delwart EL, Saif LJ, Wang Q. Genetic Characterization and Classification of Human and Animal Sapoviruses. PLoS One. 2016;11(5):e0156373.View ArticlePubMedPubMed CentralGoogle Scholar
  5. Dufkova L, Scigalkova I, Moutelikova R, Malenovska H, Prodelalova J. Genetic diversity of porcine sapoviruses, kobuviruses, and astroviruses in asymptomatic pigs: an emerging new sapovirus GIII genotype. Arch Virol. 2013;158(3):549–58.View ArticlePubMedGoogle Scholar
  6. Liu GH, Li RC, Huang ZB, Yang J, Xiao CT, Li J, Li MX, Yan YQ, Yu XL. RT-PCR test for detecting porcine sapovirus in weanling piglets in Hunan Province, China. Trop Anim Health Prod. 2012;44(7):1335–9.View ArticlePubMedGoogle Scholar
  7. Farkas T, Zhong WM, Jing Y, Huang PW, Espinosa SM, Martinez N, Morrow AL, Ruiz-Palacios GM, Pickering LK, Jiang X. Genetic diversity among sapoviruses. Arch Virol. 2004;149(7):1309–23.View ArticlePubMedGoogle Scholar
  8. Chang KO, Sosnovtsev SV, Belliot G, Wang Q, Saif LJ, Green KY. Reverse genetics system for porcine enteric calicivirus, a prototype sapovirus in the Caliciviridae. J Virol. 2005;79(3):1409–16.View ArticlePubMedPubMed CentralGoogle Scholar
  9. Tse H, Chan WM, Li KS, Lau SK, Woo PC, Yuen KY. Discovery and genomic characterization of a novel bat sapovirus with unusual genomic features and phylogenetic position. PLoS One. 2012;7(4):e34987.View ArticlePubMedPubMed CentralGoogle Scholar
  10. Hansman GS, Takeda N, Oka T, Oseto M, Hedlund KO, Katayama K. Intergenogroup recombination in sapoviruses. Emerg Infect Dis. 2005;11(12):1916–20.View ArticlePubMedGoogle Scholar
  11. Dey SK, Mizuguchi M, Okitsu S, Ushijima H. Novel recombinant sapovirus in Bangladesh. Clin Lab. 2011;57(1-2):91–4.PubMedGoogle Scholar
  12. Phan TG, Okitsu S, Muller WE, Kohno H, Ushijima H. Novel recombinant sapovirus, Japan. Emerg Infect Dis. 2006;12(5):865–7.View ArticlePubMedPubMed CentralGoogle Scholar
  13. Katayama K, Miyoshi T, Uchino K, Oka T, Tanaka T, Takeda N, Hansman GS. Novel recombinant sapovirus. Emerg Infect Dis. 2004;10(10):1874–6.View ArticlePubMedPubMed CentralGoogle Scholar
  14. Yang JS, Song DS, Kim SY, Lyoo KS, Park BK. Detection of porcine circovirus type 2 in feces of pigs with or without enteric disease by polymerase chain reaction. J Vet Diagn Invest. 2003;15(4):369–73.View ArticlePubMedGoogle Scholar
  15. Jiang X, Huang PW, Zhong WM, Farkas T, Cubitt DW, Matson DO. Design and evaluation of a primer pair that detects both Norwalk- and Sapporo-like caliciviruses by RT-PCR. J Virol Methods. 1999;83(1-2):145–54.View ArticlePubMedGoogle Scholar
  16. Chen X, Zhang Q, He C, Zhang L, Li J, Zhang W, Cao W, Lv YG, Liu Z, Zhang JX, Shao ZJ. Recombination and natural selection in hepatitis E virus genotypes. J Med Virol. 2012;84(9):1396–407.View ArticlePubMedGoogle Scholar
  17. Scotto-Lavino E, Du GW, Frohman MA. 3 ' End cDNA amplification using classic RACE. Nat Protoc. 2006;1(6):2742–5.View ArticlePubMedGoogle Scholar
  18. Kumar S, Tamura K, Nei M. MEGA3: Integrated software for molecular evolutionary genetics analysis and sequence alignment. Brief Bioinform. 2004;5(2):150–63.View ArticlePubMedGoogle Scholar
  19. Martin D, Rybicki E. RDP: detection of recombination amongst aligned sequences. Bioinformatics. 2000;16(6):562–3.View ArticlePubMedGoogle Scholar
  20. Evermann JF, Smith AW, Skilling DE, McKeirnan AJ. Ultrastructure of newly recognized caliciviruses of the dog and mink. Arch Virol. 1983;76(3):257–61.View ArticlePubMedGoogle Scholar
  21. Wang QH, Han MG, Funk JA, Bowman G, Janies DA, Saif LJ. Genetic diversity and recombination of porcine sapoviruses. J Clin Microbiol. 2005;43(12):5963–72.View ArticlePubMedPubMed CentralGoogle Scholar
  22. Martella V, Lorusso E, Banyai K, Decaro N, Corrente M, Elia G, Cavalli A, Radogna A, Costantini V, Saif LJ, Lavazza A, Di Trani L, Buonavoglia C. Identification of a porcine calicivirus related genetically to human sapoviruses. J Clin Microbiol. 2008;46(6):1907–13.View ArticlePubMedPubMed CentralGoogle Scholar
  23. Bank-Wolf BR, Konig M, Thiel HJ. Zoonotic aspects of infections with noroviruses and sapoviruses. Vet Microbiol. 2010;140(3-4):204–12.View ArticlePubMedGoogle Scholar
  24. Kitamoto N, Oka T, Katayama K, Li TC, Takeda N, Kato Y, Miyoshi T, Tanaka T. Novel monoclonal antibodies broadly reactive to human recombinant sapovirus-like particles. Microbiol Immunol. 2012;56(11):760–70.View ArticlePubMedGoogle Scholar
  25. Shen Q, Zhang W, Yang SX, Chen Y, Ning HB, Shan TL, Liu JF, Yang ZB, Cui L, Zhu JG, Hua XG. Molecular detection and prevalence of porcine caliciviruses in eastern China from 2008 to 2009. Arch Virol. 2009;154(10):1625–30.View ArticlePubMedGoogle Scholar
  26. Zhang W, Shen Q, Hua XG, Cui L, Liu JF, Yang SX. The first Chinese porcine sapovirus strain that contributed to an outbreak of gastroenteritis in piglets. J Virol. 2008;82(16):8239–40.View ArticlePubMedPubMed CentralGoogle Scholar
  27. Gao ZY, Li XT, Yan HQ, Li WH, Jia L, Hu L, Hu H, Liu BW, Li J, Wang QY. Human calicivirus occurrence among outpatients with diarrhea in Beijing, China, between April 2011 and March 2013. J Med Virol. 2015;87(12):2040–7.View ArticlePubMedGoogle Scholar
  28. Bergallo M, Galliano I, Montanari P, Brusin MR, Finotti S, Paderi G, Gabiano C. Development of a quantitative real-time PCR assay for sapovirus in children under 5-years-old in Regina Margherita Hospital of Turin, Italy. Can J Microbiol. 2017;63:1–7.Google Scholar
  29. Li L, Shan T, Wang C, Cote C, Kolman J, Onions D, Gulland FM, Delwart E. The fecal viral flora of California sea lions. J Virol. 2011;85(19):9909–17.View ArticlePubMedPubMed CentralGoogle Scholar
  30. Oka T, Yamamoto M, Katayama K, Hansman GS, Ogawa S, Miyamura T, Takeda N. Identification of the cleavage sites of sapovirus open reading frame 1 polyprotein. J Gen Virol. 2006;87(Pt 11):3329–38.View ArticlePubMedGoogle Scholar
  31. Nakamura K, Saga Y, Iwai M, Obara M, Horimoto E, Hasegawa S, Kurata T, Okumura H, Nagoshi M, Takizawa T. Frequent detection of noroviruses and sapoviruses in swine and high genetic diversity of porcine sapovirus in Japan during Fiscal Year 2008. J Clin Microbiol. 2010;48(4):1215–22.View ArticlePubMedPubMed CentralGoogle Scholar
  32. Mathijs E, Muylkens B, Mauroy A, Ziant D, Delwiche T, Thiry E. Experimental evidence of recombination in murine noroviruses. J Gen Virol. 2010;91(Pt 11):2723–33.View ArticlePubMedGoogle Scholar
  33. Mathijs E, Oliveira-Filho EF, Dal Pozzo F, Mauroy A, Thiry D, Massart F, Saegerman C, Thiry E. Infectivity of a recombinant murine norovirus (RecMNV) in Balb/cByJ mice. Vet Microbiol. 2016;192:118–22.View ArticlePubMedGoogle Scholar

Copyright

© The Author(s). 2017

Advertisement