Isolation and identification of a distinct strain of Culex Flavivirus from mosquitoes collected in Mainland China

  • Wang Huanyu1,

    Affiliated with

    • Wang Haiyan2,

      Affiliated with

      • Fu Shihong1,

        Affiliated with

        • Liu Guifang2,

          Affiliated with

          • Liu Hong1,

            Affiliated with

            • Gao Xiaoyan1,

              Affiliated with

              • Song Lizhi2,

                Affiliated with

                • Simon Rayner3,

                  Affiliated with

                  • Xu Aiqiang2 and

                    Affiliated with

                    • Liang Guodong1Email author

                      Affiliated with

                      Virology Journal20129:73

                      DOI: 10.1186/1743-422X-9-73

                      Received: 19 October 2011

                      Accepted: 27 March 2012

                      Published: 27 March 2012

                      Abstract

                      Background

                      Culexflavivirus (CxFV) is an insect specific virus that has been isolated from Culexpipiens, Culexquinquefasciatus, Culextritaeniorhynchus and other Culex mosquitoes. It is a novel flavivirus isolated in Asia, North America, Central America and Africa. Phylogenetic analysis indicates that, based on the envelope gene (E gene) sequence, the worldwide CxFV strains can be divided into two genotypes.

                      Result

                      A virus (SDDM06-11) was isolated from Culexpipiens collected in Shandong Province, China in 2006. The strain caused cytopathic effect (CPE) in Aedesalbopictus (C6/36) cells by 3 days post-infection and immunofluorescence assay (IFA) showed a reaction with Japanese encephalitis virus (JEV) polyclonal antibodies. Phylogenetic analysis of the E gene sequence showed CxFV formed two genotypes with the SDDM06-11 strain assigned to genotype 1. Analysis of the E gene nucleotide homology showed the virus possessed characteristic amino acids at specific sites. The nucleotide homology of the open reading frame (ORF) was 94.8%-95.1% between SDDM06-11 and isolates from Japan, Iowa and Texas, and 90.2%-90.5% between SDDM06-11 and isolates from Uganda and Mexico.

                      Conclusion

                      In this paper we report the first isolation and identification of an isolate of CxFV in mainland China. Phylogenetic analysis indicates the isolate belongs to genotype 1. Our findings provide insight into the occurrence of CxFV in Culex mosquito populations and its distribution on a global scale.

                      Keywords

                      CulexFlavivirus Genotype Mosquitoes

                      Background

                      The genus Flavivirus in the family Flaviviridae is a group of single stranded positive sense RNA viruses that are primarily arthropod borne [1]. Phylogenetic analysis classifies these viruses into mosquito-borne, tick-borne, no known vector and viruses that are specific to insects, but which do not infect vertebrates [2, 3]. This final group includes cell fusing agent virus (CFAV) [4], Kamiti River virus (KRV)[5] and Culexflavivirus (CxFV)[6].

                      CxFV is an insect-specific virus that can replicate in C6/36 cells but not in other mammalian cell lines. CxFV was first isolated in 2003 in Japan (in species Culexpipiens and Culextritaeniorhynchus) and then in Indonesia in 2004 (Culexquinquefasciatus)[6]. Subsequently the virus has been isolated in North America: Iowa and Texas in the United States [7, 8] (2007-2008, Culexquinquefasciatus, Culexrestuans); Central America: Guatemala (2006, Culexquinquefasciatus) [9], the Yucatan peninsula in Mexico [10, 11] (2007-2008, Culexquinquefasciatus, Culexinterrogator); Trinidad in the West Indies [8] (2008, Culexquinquefasciatus); and Uganda, Africa [12] (2008, Culexquinquefasciatus). E gene phylogenetic analysis of these isolates showed that they can be clearly divided into two genotypes [8, 9].

                      Relatively few flaviviruses have been isolated in China, the most common of which are Japanese encephalitis virus (JEV), dengue virus (DENV) and tick-borne encephalitis virus (TBEV) with presence of associated disease symptoms [13, 14]. In recent years, a novel insect-specific Flavivirus was isolated from Aedesvexans in rural corrals in Chaoyang city in Liaoning province in China [15], but the distribution and significance of these insect specific viruses remains unclear in China.

                      In this study, we report the isolation and identification of a distinct strain of CxFV from Culexpipiens mosquitoes collected in Shandong Province in China in 2006 and perform nucleotide sequencing analysis in order to compare with other CxFV isolates previously collected from around the world.

                      Methods

                      Mosquito collection

                      Mosquitoes used in this study were collected in August in 2006 in Dongming county, Shandong province, China. Mosquitoes were collected using light traps (Hubei Lucky Star Environment Protection Co., Ltd.) in fields, pig farms and dwellings. The traps were placed before sunset and mosquitoes were collected from the traps the following morning after sunrise. Collected mosquitoes were frozen for 30 min at -20°C then placed on an ice plate to determine mosquito species and exclude blood-fed and/or male mosquitoes [16]. The mosquitoes were sorted according to species with 50 to 100 adults per pool, transported on dry ice and then stored in liquid nitrogen in the laboratory.

                      Cell culture and virus isolation

                      Mosquito cell line C6/36 and baby hamster kidney (BHK-21) cell line were used for virus isolation. The two cell lines were cultured with Eagle's minimum essential medium (MEM) (Sigma-Aldrich, USA) with 10% heat-inactivated fetal bovine serum (FBS) (Sigma), 2% non-essential amino acid (Sigma), 100 U/ml penicillin (Gibco, Invitrogen, USA), 100 μg/ml streptomycin (Gibco), and maintained at 28°C (for mosquito cells) and 37°C (for mammalian cells) with 5% CO2.

                      Pools of mosquitoes were homogenized using a Mixer Mill (Tissuelyser, Qiagen, Germany) and 3 mm stainless steel beads in 2 mL sterile plastic tubes and 1.5 mL of MEM containing 2% fetal bovine serum, 2 mM L-glutamine, 50 units/mL Penicillin and 100 ug/mL Streptomycin (Gibco Cat No 15140). Samples were centrifuged at 12,000 rpm for 20 minutes at 4°C. Then, 200 μl of the clarified homogenates were inoculated into single 5.5 cm2 Nunc tubes (Nunclon, Denmark) spread with a monolayer of C6/36 and BHK-21 cells respectively for 1 h at constant temperature. After discarding and refreshing with 500 μl medium, the cell cultures were incubated with the same conditions for 6-7 days. Cytopathic effects (CPE) were checked every 8 hours after incubation for 24 hours and observation over the next 6-7 days. At 70% CPE (3 days after post-infection), the culture supernatants were harvested and cellular debris was removed by centrifugation at 12,000 rpm. The supernatants were stored at -80°C until identification.

                      Indirect immunofluorescence assay

                      Virus isolate in cell culture was identified by indirect immunofluorescence assay (IFA). Infected and uninfected cell suspensions were applied to Teflon-coated 10-well slides, which were then air dried and fixed in acetone. The IFA was conducted with a panel of antiserum with fluorescein isothiocyanate-conjugated goat anti-mouse IgG as the second antibody (Sigma) by previously described procedures [17]. The panel of polyclonal antibody (JEV-GSS) against JEV was prepared by our laboratory [18].

                      RT-PCR and nucleotide sequencing

                      Viral RNA was extracted from 140 μl of virus culture stocks using the QIAamp viral RNA extraction kit (Qiagen, Valencia, CA, USA) in accordance with the manufacturer's protocol and stored at -70°C until use. Briefly, purified RNA was used as template to finish the reverse transcription-polymerase chain reactions (RT-PCR) for cDNA synthesis using Ready-To-Go™ You-Prime First-Strand Beads (Amersham Biosciences, Piscatway, NJ, USA) and supplied random hexanucleotide primers. Flavivirus genus-specific primer sets [3] were used for identification. Then ten overlapping primers (Table 1) were designed from the Tokyo strain genome sequence (GenBank number: AB262759) to amplify the complete open reading frame (ORF) nucleotide sequence of the viral genomic RNA.
                      Table 1

                      Degenerate primer sequences used for viral screening and primer sets used for SDDM06-11

                      Primer

                      Position a

                      Sequence, 5'-3'

                      Polarity

                      CxFV-SD-1-F

                      21-39

                      TGGTTACACCGCAGATTG

                      Sense

                      CxFV-SD-1-R

                      1198-1217

                      GATTGTAGGGCTGGGTTGAG

                      Reverse

                      CxFV-SD-2-F

                      1034-1049

                      AACGGACTTCTTGAGTTTCGC

                      Sense

                      CxFV-SD-2-R

                      2197-2217

                      GCCTTGGTGTAGACAAAGTATC

                      Reverse

                      CxFV-SD-3-F

                      2002-2020

                      GCAAGGTTGGAGAATGGC

                      Sense

                      CxFV-SD-3-R

                      3238-3256

                      GACCTTGAAGTGAAATACCC

                      Reverse

                      CxFV-SD-4-F

                      3034-3055

                      GTCTAAAGCAAACCACATTCC

                      Sense

                      CxFV-SD-4-R

                      4233-4255

                      CGGTCCGTAAGTTCCTTCTAAT

                      Reverse

                      CxFV-SD-5-F

                      3880-3989

                      CTATGCTGTGACGCATCCTG

                      Sense

                      CxFV-SD-5-R

                      6232-6254

                      AAGCCACAAATAGTCCATACAG

                      Reverse

                      CxFV-SD-6-F

                      6048-6069

                      ACTCAGTGCTGTTTCAAGG

                      Sense

                      CxFV-SD-6-R

                      7204-7226

                      CTCGTCCTGTTATCTCATCGTC

                      Reverse

                      CxFV-SD-7-F

                      7021-7039

                      GATTTCCTGGGAGACGAT

                      Sense

                      CxFV-SD-7-R

                      8319-8337

                      TCTCGCAACCTCTTCACG

                      Reverse

                      CxFV-SD-8-F

                      8012-8033

                      TTCTGTTGTAAGGTGCTGTCT

                      Sense

                      CxFV-SD-8-R

                      9326-9344

                      GGTTCTTCCCATTCGTCA

                      Reverse

                      CxFV-SD-9-F

                      9140-9159

                      CTGGACCAAGTGACTGACC

                      Sense

                      CxFV-SD-9-R

                      10332-10350

                      TGGCTGCGAGGGTGACTT

                      Reverse

                      CxFV-SD-10-F

                      10016-10038

                      AGTTTGATTGGTGAGCGGGACA

                      Sense

                      CxFV-SD-10-R

                      10794-10815

                      CCCGCAACAAGTCTCCTAACG

                      Reverse

                      a The nucleotide position was according to the CxFV strain Tokyo genome.

                      To avoid any potential contamination, JEV RNA and water were used as positive and negative controls respectively at all stages. RT-PCR products were purified using a commercial kit (ExoSAP-IT PCR Purification Kit, USB, USA). PCR products were sequenced using a PRIMS Ready Reaction Dyedeoxy Terminator Cycle Sequencing Kit on an ABI Prism 3100 Avant Genetic Analyser (Applied Biosystems, California, USA) using the PCR primer sets listed in Table 1. Dye terminator sequencing was used for both strands with double coverage and the results were inspected for accuracy and quality. After sequencing we got the ATGC software package (GENETYX Corp., Tokyo, Japan) was used to complete the sequence assembly.

                      Sequence data for the E and ORF gene of strain SDDM06-11 were deposited in GenBank with accession number JF938690 and JQ518484, respectively.

                      Sequence analysis and phylogenetic comparisons

                      Additional CxFV sequences were downloaded from GenBank, a list of the 49 CxFV isolates used in the analyses with origin and year of isolation is shown in Table 2. Nucleotide and amino acid sequence alignments were generated by CLUSTAL_X version 1.8 [19]. The optimal nucleotide substitution model was estimated as the General Time Reversible with rate heterogeneity among sites and invariable sites using Akaike Information Criterion as implemented in jModeltest v.0.1.1 (http://​darwin.​uvigo.​es/​software/​jmodeltest.​html). The phylogenetic tree was computed with the GTR + I + G model using the maximum likelihood approach with the PHYML software package [20]. The statistical significance of the phylogeny was estimated by the nonparametric bootstrap analysis with 100 replicates.
                      Table 2

                      Details of Culexflavivirus (CxFV) strains used in this study

                      No.

                      Strain

                      Year

                      Geographic Location

                       

                      GenBank accession no.

                         

                      Country

                      Location

                      Source/Host

                       

                      1

                      SDDM06-11*

                      2006

                      China

                      Dongming

                      Culexpipiens

                      JF938690

                      2

                      Tokyo

                      2003

                      Japan

                      Tokyo-Shinjuku

                      Culexpipiens

                      NC_008604/AB262759

                      3

                      NIID-21-2

                      2004

                      Japan

                      Tokyo-Shinjuku

                      Culexpipiens

                      AB377213

                      4

                      Narita

                      2003

                      Japan

                      Chiba-Narita

                      Culexpipiens

                      AB262760

                      5

                      Toyama

                      2003

                      Japan

                      Toyama

                      Culexpipiens

                      AB262761

                      6

                      Hokkaido

                      2003

                      Japan

                      Hokkaido-Abashiri

                      Culexpipiens

                      AB262762

                      7

                      Osaka

                      2003

                      Japan

                      Osaka

                      Culexpipiens

                      AB262763

                      8

                      Mie-Cp

                      2004

                      Japan

                      Mie-Tsu

                      Culexpipiens

                      AB262764

                      9

                      Morioka

                      2003

                      Japan

                      Iwate-Morioka

                      Culexpipiens

                      AB262765

                      10

                      Mie-Ct

                      2004

                      Japan

                      Mie-Tsu

                      Culextritaeniorhynchus

                      AB262767

                      11

                      Surabaya

                      2004

                      Indonesia

                      Surabaya

                      Culexquinquefasciatus

                      AB262766

                      12

                      Izabal

                      2006

                      Guatemala

                      Puerto Rico Izabal

                      Culexquinquefasciatus

                      EU805805

                      13

                      HOU24518

                      2008

                      USA

                      Texas-Harris county

                      Culexquinquefasciatus

                      FJ502995

                      14

                      HOU24519

                      2008

                      USA

                      Texas-Harris county

                      Culexrestuans

                      FJ502996

                      15

                      HOU24284

                      2008

                      USA

                      Texas-Harris county

                      Culexrestuans

                      FJ502997

                      16

                      HOU24471

                      2008

                      USA

                      Texas-Harris county

                      Culexrestuans

                      FJ502998

                      17

                      HOU24516

                      2008

                      USA

                      Texas-Harris county

                      Culexquinquefasciatus

                      FJ502999

                      18

                      HOU24559

                      2008

                      USA

                      Texas-Harris county

                      Culexquinquefasciatus

                      FJ503001

                      19

                      TR3115

                      2008

                      West Indies, Trinidad

                      Champs Fleur

                      Culexquinquefasciatus

                      FJ503002

                      20

                      HOU24522

                      2008

                      USA

                      Texas-Harris county

                      Culexquinquefasciatus

                      FJ503000

                      21

                      TR3116

                      2008

                      West Indies, Trinidad

                      Champs Fleur

                      Culexquinquefasciatus

                      FJ503003

                      22

                      CxFV-Mex07

                      2007

                      Mexico

                      Yucatan State

                      Culexquinquefasciatus

                      EU879060

                      23

                      1064

                      2007

                      USA

                      Iowa

                      Culexpipiens

                      FJ663026

                      24

                      380

                      2007

                      USA

                      Iowa

                      Culexpipiens

                      FJ663027

                      25

                      383

                      2007

                      USA

                      Iowa

                      Culexpipiens

                      FJ663028

                      26

                      635

                      2007

                      USA

                      Iowa

                      Culexpipiens

                      FJ663029

                      27

                      318

                      2007

                      USA

                      Iowa

                      Culexpipiens

                      FJ663030

                      28

                      377

                      2007

                      USA

                      Iowa

                      Culexpipiens

                      FJ663031

                      29

                      599

                      2007

                      USA

                      Iowa

                      Culexpipiens

                      FJ663032

                      30

                      657

                      2007

                      USA

                      Iowa

                      Culexpipiens

                      FJ663033

                      31

                      Iowa07

                      2007

                      USA

                      Iowa

                      Culexpipiens

                      FJ663034

                      32

                      Uganda08

                      2008

                      Uganda

                      Entebbe

                      Culexquinquefasciatus

                      GQ165808

                      33

                      T955

                      2008

                      Mexico

                      Yucatan Peninsula

                      Culexinterrogator

                      GU289683

                      34

                      M2168

                      2008

                      Mexico

                      Yucatan Peninsula

                      Culexquinquefasciatus

                      GU289684

                      35

                      M2313

                      2008

                      Mexico

                      Yucatan Peninsula

                      Culexquinquefasciatus

                      GU289685

                      36

                      M2605

                      2008

                      Mexico

                      Yucatan Peninsula

                      Culexquinquefasciatus

                      GU289686

                      37

                      M2614

                      2008

                      Mexico

                      Yucatan Peninsula

                      Culexquinquefasciatus

                      GU289687

                      38

                      M2617

                      2008

                      Mexico

                      Yucatan Peninsula

                      Culexquinquefasciatus

                      GU289688

                      39

                      M2618

                      2008

                      Mexico

                      Yucatan Peninsula

                      Culexquinquefasciatus

                      GU289689

                      40

                      M2630

                      2008

                      Mexico

                      Yucatan Peninsula

                      Culexquinquefasciatus

                      GU289690

                      41

                      M2635

                      2008

                      Mexico

                      Yucatan Peninsula

                      Culexquinquefasciatus

                      GU289691

                      42

                      M2636

                      2008

                      Mexico

                      Yucatan Peninsula

                      Culexquinquefasciatus

                      GU289692

                      43

                      M2637

                      2008

                      Mexico

                      Yucatan Peninsula

                      Culexquinquefasciatus

                      GU289693

                      44

                      M2644

                      2008

                      Mexico

                      Yucatan Peninsula

                      Culexquinquefasciatus

                      GU289694

                      45

                      M2645

                      2008

                      Mexico

                      Yucatan Peninsula

                      Culexquinquefasciatus

                      GU289695

                      46

                      M2648

                      2008

                      Mexico

                      Yucatan Peninsula

                      Culexquinquefasciatus

                      GU289696

                      47

                      M2650

                      2008

                      Mexico

                      Yucatan Peninsula

                      Culexquinquefasciatus

                      GU289697

                      48

                      M2656

                      2008

                      Mexico

                      Yucatan Peninsula

                      Culexquinquefasciatus

                      GU289698

                      49

                      M2663

                      2008

                      Mexico

                      Yucatan Peninsula

                      Culexquinquefasciatus

                      GU289699

                      50

                      M2665

                      2008

                      Mexico

                      Yucatan Peninsula

                      Culexquinquefasciatus

                      GU289700

                      *Sequence of SDDM06-11 was used in the present study.

                      Neighbor Joining (NJ) and Maximum Likelihood (ML) trees were also estimated for the nucleotide alignments using PHYLIP, v3.6-alpha (http://​atgc.​lirmm.​fr/​phyml) and MEGA v5.1 with empirical base frequencies, and a gamma distribution to estimate rate variation among sites. Bootstrap values were determined for 100 replicates.

                      The trees were rooted using a CRFV (GenBank accession no. NC001564) sequence as the outgroup. Analysis of nucleotide and translated amino acid sequence identities for the E and ORF sequences was performed using the GeneDoc and Lasergene software packages (DNASTAR Inc, USA).

                      Results

                      Virus isolation and identification

                      A total of 80 pools consisting of 4118 Culextritaeniorhynchus, 839 Culexpipiens and 27 Anopheles sinensis were collected from Dongming county, Shandong province, China, from August 9 to 11, 2006 and were processed for virus isolation. A virus isolate was identified that caused CPE in C6/36 cells and which was characterized by marked syncytia, aggregation and fusion by day 3 post-infection (Figure 1A and 1B); no CPE was observed in BHK-21 cells. Antigen IFA using JEV polyclonal antibody (JEV-GSS) identified the isolate as a flavivirus (Figure 2A and 2B). RT-PCR amplification using flavivirus primers FU1 and cFD2 [3]. BLASTN analysis against the nr database at NCBI showed the highest scoring hits were all from CxFV with 95% similarity and an E-value of 0. The isolate was designated SDDM06-11.
                      http://static-content.springer.com/image/art%3A10.1186%2F1743-422X-9-73/MediaObjects/12985_2011_1751_Fig1_HTML.jpg
                      Figure 1

                      Phase contrast photomicrographs of control and infected C6/36 cells after infection. (A) Control cells. (B) Cells 3 days after infection with SDDM06-11. Note the extensive cell fusion and syncytia formation in the infected cells. Microscope settings Ocular: 10; Lens: 10X. Scale bar, 50 μm.

                      http://static-content.springer.com/image/art%3A10.1186%2F1743-422X-9-73/MediaObjects/12985_2011_1751_Fig2_HTML.jpg
                      Figure 2

                      Immunofluorescence assay (IFA) of SDDM06-11 using JEV polyclonal antibody (JEV-GSS). (A) C6/36 cell control (uninfected) stained by IFA, using JEV polyclonal antibody (JEV-GSS). (B) SDDM06-11 antigen in infected C6/36 cells, as detected by IFA, using JEV polyclonal antibody (JEV-GSS). Scale bar, 50 μm.

                      Analysis of the E gene sequence

                      Table 3 shows a summary of the nucleotide and amino acid identities for the E gene according to genotype and geographical location amongst strains used in the phylogenetic analysis.
                      Table 3

                      Percentage nucleotide/amino acid identity for the envelope genes among Culexflavivirus isolates from different countries and genotypes

                          

                      GENOTYPE 1

                         

                      GENOTYPE 2

                       
                        

                      China

                      Japan

                      Indonesia

                      Texas

                      Iowa

                      Mexico

                      Guatemala

                      Trinidad

                      Uganda

                       

                      China

                      --

                      94.6

                      94.8

                      94.5

                      94.4

                      89.4

                      89.7

                      89.6

                      90.2

                       

                      Japan

                      98.6

                      --

                      97.5

                      97.4

                      97.4

                      89.1

                      89.3

                      89.3

                      90.2

                      GEN 1

                      Indonesia

                      98.4

                      99.3

                      --

                      97.4

                      97.3

                      89.9

                      90.1

                      90.1

                      90.9

                       

                      Texas

                      98.6

                      99.5

                      99.3

                      --

                      99.6

                      89.8

                      89.9

                      89.5

                      90.6

                       

                      Iowa

                      98.6

                      99.5

                      99.3

                      100

                      --

                      90

                      90.2

                      89.8

                      90.8

                       

                      Mexico

                      97.9

                      97.4

                      97.2

                      97.4

                      97.4

                      --

                      99.2

                      98.4

                      97.9

                       

                      Guatemala

                      97.9

                      97.4

                      97.2

                      97.4

                      97.4

                      100

                      --

                      98.4

                      97.9

                      GEN 2

                      Trinidad

                      97.9

                      97.4

                      97.2

                      97.4

                      97.4

                      100

                      100

                      --

                      98

                       

                      Uganda

                      97.9

                      97.4

                      97.2

                      97.4

                      97.4

                      99.5

                      99.5

                      99.5

                      --

                      Percentage nucleotide and amino acid homology between and amongst genotypes and countries; nucleotide divergence is displayed in bold type in upper triangle, amino acid homology is displayed in regular type in lower triangle. Alignments were performed using the following CxFV isolates: SDDM06-11 (China), NIID-21-2 (Japan), Surabaya (Indonesia), TX 24518 (Texas), 380 (Iowa) belonging to Genotype 1 and CxFV-Mex07 (Mexico), Izabal (Guatemala), TR3116 (Trinidad) and Uganda08 (Uganda) belonging to Genotype 2.

                      Specifically, the nucleotide identity between SDDM06-11 and genotype 1 strains (Japan, Indonesia and North America) (Iowa and Texas) was 94.4%-94.8%, and the corresponding identity of SDDM06-11 with genotype 2 (Uganda, Trinidad, Guatemala and Mexico) was 89.4%-90.2%. The identity between genotype 1 and genotype 2 was 89.1%-90.9%. The within genotype identity for genotype 1 was 94.4%-99.6% and within genotype 2 was 97.9%-99.2%. The E gene amino acid identity amongst all the CxFV strains was 97.2%-100%(Table 3).

                      Examination of the amino acid sequence for the E gene indicated that each genotype contained site-specific mutations (Table 4). A total of ten mutations were identified that were specific to genotype I and 2; these occurred at E-60 (Val), E-64 (Phe), E-117 (Gly), E-185 (His), E-236 (Val), E-326 (Arg), E-340 (Ile), E381 (His) E-407E (Leu), E-423 (Ile). Mutations that were unique to SDDM06-11 (i.e., that were not present in genotype 1 or 2) occurred at E-125 (Val) and E-414 (Val).
                      Table 4

                      Deduced amino acid substitutions for CxFV by genotype in the E gene

                      Genotype1

                           

                      Residue2

                           
                       

                      E-60

                      E-64

                      E-117

                      E-125

                      E-185

                      E-236

                      E-326

                      E-340

                      E-381

                      E-407

                      E-414

                      E-423

                      G1

                      V (Val)

                      F (Phe)

                      G (Gly)

                      I (Ile)

                      H (His)

                      V (Val)

                      R (Arg)

                      V (Val)

                      H (His)

                      F (Phe)

                      F (Phe)

                      V (Val)

                      G2

                      A 3 (Ala)

                      Y (Tyr)

                      E (Glu)

                      I (Ile)

                      Y (Tyr)

                      I (Ile)

                      K (Lys)

                      I (Ile)

                      Y (Tyr)

                      L (Leu)

                      F (Phe)

                      I (Ile)

                      SDDM06-11

                      V (Val)

                      F (Phe)

                      G (Gly)

                      V (Val)

                      H (His)

                      V (Val)

                      R (Arg)

                      I (Ile)

                      H (His)

                      L (Leu)

                      V (Val)

                      I (Ile)

                      1G1: Japan and Indonesia, USA:TX/Iowa; G2: Uganda, Guatemala, Mexico, West Indies;

                      2 Amino acid positions are determined from the sequence alignment of the completely E sequenced isolates of CxFV.

                      3 Boldface indicates deduced amino acid specific to that genotype.

                      Analysis of the ORF gene sequence

                      The nucleotide and deduced amino acid sequences of the ORF of SDDM06-11 were compared with those of six other CxFV strains selected from the GenBank database. The nucleotide identity between SDDM06-11 and other genotype 1 sequences (Japan, Iowa and Texas) was 94.8%-95.1%, and between SDDM06-11 and genotype 2 sequences (Uganda and Mexico) was 90.2%-90.5%. The calculated amino acid identity for all the CxFV strains was 96.5%-98.2% (Table 5). The highest nucleotide identity occurred in the NS2a and NS2b genes, where the nucleotide identity between SDDM06-11 and genotype 1 strains was > 98% and > 96% respectively;. For genotype 2, the identity was > 94% and > 92% respectively. however, the amino acid homology was lower than ORF (Table 5).
                      Table 5

                      Nucleotide and amino acid of ORF sequence comparison (% sequence identity) of strain SDDM06-11 with selected CxFV isolates

                      SDDM06-11

                      C

                      PrM

                      E

                      NS1

                      NS2a

                      NS2b

                      NS3

                      NS4a

                      NS4b

                      NS5

                      Total

                       

                      417(139)a

                      429 (143)

                      1281 (427)

                      1107 (369)

                      690 (230)

                      381 (127)

                      1779 (593)

                      567 (189)

                      771 (257)

                      2667 (889)

                      10089 (3363)

                      Tokyo

                      94.5 (95.0)b

                      95.3 (98.6)

                      94.6 (98.6)

                      94.7 (99.2)

                      98.3 (97.8)

                      96.9 (94.5)

                      94.3 (97.5)

                      94.0 (98.4)

                      94.0 (97.3)

                      94.7 (98.7)

                      94.9 (98.0)

                      NIID-21-2

                      94.7 (95.0)

                      95.6 (99.3)

                      94.6 (98.6)

                      94.8 (99.2)

                      98.3 (97.8)

                      96.9 (94.5)

                      94.5 (97.6)

                      94.0 (98.4)

                      94.0 (97.3)

                      95.0 (99.1)

                      95.0 (98.2)

                      Iowa07

                      95.0 (94.2)

                      95.6 (99.3)

                      95.0 (98.8)

                      94.8 (99.2)

                      98.6 (98.3)

                      96.6 (94.5)

                      94.5 (97.5)

                      94.0 (98.4)

                      94.2 (97.3)

                      95.1 (99.3)

                      95.1 (98.2)

                      HOU24518

                      95.0 (95.0)

                      94.6 (98.6)

                      94.5 (98.6)

                      94.4 (99.2)

                      98.3 (98.3)

                      96.1 (95.3)

                      94.2 (97.5)

                      94.4 (99.5)

                      94.4 (96.9)

                      94.6 (98.7)

                      94.8 (98.1)

                      CxFV-Mex07

                      91.8 (89.9)

                      92.8 (98.6)

                      89.4 (97.9)

                      91.3 (98.1)

                      94.8 (93.9)

                      92.4 (93.7)

                      88.8 (96.5)

                      87.5 (96.3)

                      88.8 (95.7)

                      89.8 (97.5)

                      90.2 (96.6)

                      UGANDA08

                      92.3 (91.4)

                      93.0 (97.9)

                      90.2 (97.9)

                      92.0 (98.1)

                      94.8 (94.3)

                      92.9 (94.5)

                      89.3 (96.5)

                      88.4 (96.3)

                      87.7 (94.2)

                      89.8 (97.2)

                      90.5 (96.5)

                      a Nucleotide number were ahead and amino acid number shown in brackets.

                      b Percent nucleotide sequence homology were ahead and amino acid sequence homology shown in brackets.

                      Phylogenetic analysis

                      The estimated ML phylogenetic tree based on the E gene nucleotide sequence is shown in Figure 3 and is consistent with the trees estimated for the using the NJ and ML methods using MEGA v5.1 (data not shown). The tree shows the CxFV strains are divided into two distinct genotypes. Genotype 1 is divided into two clades, with clade 1 incorporating sequences from Japan and Indonesia and clade 2 containing samples from the United States (Texas and Iowa) [8]. Genotype 2 contains samples from Africa (Uganda), North America (Mexico), Central America (Guatemala) and the West Indies, (Trinidad) [7]. The newly isolated Chinese strain SDDM06-11 is placed within the genotype 1 clade; however, it appears to have branched from the remaining isolates at a relatively early time point, suggesting that it belongs to a distinct cluster (Figure 3).
                      http://static-content.springer.com/image/art%3A10.1186%2F1743-422X-9-73/MediaObjects/12985_2011_1751_Fig3_HTML.jpg
                      Figure 3

                      Phylogenetic analysis based on the E gene of CxFV strain isolated in China. Phylogenetic tree generated using the ML method. The tree was rooted by using CRFV (GenBank accession no. NC001564) sequence as the outgroup. Horizontal branch lengths are proportional to genetic distance; scale bars indicate a genetic distance of 10-nt substitutions per site. Isolate obtained in Shandong Province is shown in boldface and blue. Isolates from United States are shown in red and isolates from Japan and Indonesia are shown in green. See Table 2 for sequence information. CN: China; US: United States; JP: Japan; ID: Indonesia.

                      Discussion

                      We report here the first isolation of a strain of CxFV in China. This strain is distinct from other isolates collected from around the world, containing signature amino acid mutations and forming a separate cluster in the estimated phylogenetic tree. This sample appears therefore to represent a new cluster within genotype 1; this is also supported by the analysis of the amino acid substitutions in the E protein; many of the mutations were shared by these genotypes, whereas SDDM06-11 contains several unique substitutions.

                      Investigation of the CPE of this strain also produced distinctive results. Previous studies of CPE produced by CxFV in C6/36 cells found that some genotype 1 strains could generate marked CPE in cells within 6 to 7 days but no such changes have been observed for genotype 2 strains [7, 9, 10]. For the SDDM06-11 from China the CPE was similar to observations for genotype 1 [6, 8], producing marked CPE but with a more rapid onset of effects (3-4 days) This difference may be a consequence of the detected amino acid changes in the E gene, but detailed experimental studies are necessary to gain further insight and understanding of the observed differences between the two genotypes.

                      The genotypes are formed with high bootstrap support and contain clear geographical subdivision, but on a global scale the geographical distribution is less clear with North America (Texas and Iowa), Japan and the Chinese isolate placed in genotype 1 and the Central America (Guatemala and Mexico), Trinidad and Africa strains placed in genotype 2. Similarly, the evolutionary relationship among the three genotypes is not apparent from the estimated phylogenetic tree. This is primarily because there are relatively few samples available for the analysis and only a partial evolutionary history of the virus can be recreated.

                      All CxFV samples to date have been isolated from members of the Culex genus, with the majority of samples collected from Culexpipiens and Culexquinquefasciatus. Genotype 2 primarily consists of Culexquinquefasciatus isolates, whereas genotype 1 is primarily Culexpipiens and contains smaller numbers of other Culex species [611]. The SDDM06-11 belonging to genotype 1 is also isolated from Culexpipiens.

                      An earlier theoretical study of species diversification derived an estimate for the relationship between the distribution of internal nodes in a tree predicted from a limited sample set and the number of different viruses from which the sample set were selected [21]. When applied to the flaviviruses genus, it was estimated that are several thousand unsampled mosquito borne flaviviruses [21]. Thus further collection and evaluation of CxFV samples is necessary to gain further insight into the evolutionary history of the virus and the host range. It is likely that this will reveal greater complexity and structure (i.e. additional genotypes and new strains) in the CxFV phylogeny and host population.

                      Conclusions

                      We have isolated and identified the CxFV strain in mainland China. Phylogenetic analysis places the isolate within genotype 1, but indicates it is quite distinct from other strains within this clade. This is further supported by analysis of the E gene and ORF sequence which shows the isolate has discrete difference in terms of nucleotide composition and amino acid mutations. Our findings suggest that CxFV may be widespread in Culex mosquito populations and could have a relevant role in the evolution of flaviviruses.

                      Authors' information

                      Dr. Wang Huanyu, Ph.D., is an associate professor at the State Key Laboratory for Infectious Disease Prevention and Control, the Institute for Viral Disease Control and Prevention, Chinese Center for Disease Control and Prevention. His current research focuses on arbovirus and viral encephalitis, especially in Flavivirus.

                      Abbreviations

                      CPE: 

                      Cytopathic Effect

                      CxFV: 

                      CulexFlavivirus

                      IFA: 

                      immunofluorescence assay

                      Declarations

                      Acknowledgements

                      We thank the staff from Shandong Province Centers for Disease Control and Prevention and the two local Centers for Disease Control and Prevention (Heze city and Dongmingcounty) for assistance with the mosquito collection.

                      This work was supported by grants from the Ministry of Science and Technology of People's Republic of China (No. 2003BA712A08-01 and No. 2008ZX10004-010), the National Natural Science Foundation of China (31070145), Development Grant of State Key Laboratory for Infectious Disease Prevention and Control (2008SKLID105).

                      Authors’ Affiliations

                      (1)
                      State Key Laboratory for Infectious Disease Prevention and Control, Department of Viral Encephalitis, Institute for Viral Disease Control and Prevention, Chinese Center for Disease Control and Prevention
                      (2)
                      Institute for Immunization Program, Shandong province Center for Disease Control and Prevention
                      (3)
                      Bioinformatics Group, State Key Laboratory for Virology, Wuhan Institute of Virology, Chinese Academy of Sciences

                      References

                      1. Fields BN, Knipe DM, Howley PM (Eds): Fields Virology 5th edition. Lippincott Williams & Wilkins; 2007:1154–1228.
                      2. Gaunt MW, Sall AA, de Lamballerie X, Falconar AK, Dzhivanian TI, Gould EA: Phylogenetic relationships of flaviviruses correlate with their epidemiology, disease association and biogeography. J Gen Virol 2001,82(Pt 8):1867–1876.PubMed
                      3. Kuno G, Chang GJ, Tsuchiya KR, Karabatsos N, Cropp CB: Phylogeny of the genus Flavivirus. J Virol 1998,72(1):73–83.PubMed
                      4. Stollar V, Thomas VL: An agent in the Aedesaegypti cell line (Peleg) which causes fusion of Aedesalbopictus cells. Virology 1975,64(2):367–377.PubMedView Article
                      5. Crabtree MB, Sang RC, Stollar V, Dunster LM, Miller BR: Genetic and phenotypic characterization of the newly described insect flavivirus, Kamiti River virus. Arch Virol 2003,148(6):1095–1118.PubMedView Article
                      6. Hoshino K, Isawa H, Tsuda Y, Yano K, Sasaki T, Yuda M, Takasaki T, Kobayashi M, Sawabe K: Genetic characterization of a new insect flavivirus isolated from Culexpipiens mosquito in Japan. Virology 2007,359(2):405–414.PubMedView Article
                      7. Blitvich BJ, Lin M, Dorman KS, Soto V, Hovav E, Tucker BJ, Staley M, Platt KB, Bartholomay LC: Genomic sequence and phylogenetic analysis of Culexflavivirus, an insect-specific flavivirus, isolated from Culexpipiens (Diptera: Culicidae) in Iowa. J Med Entomol 2009,46(4):934–941.PubMedView Article
                      8. Kim DY, Guzman H, Bueno R Jr, Dennett JA, Auguste AJ, Carrington CV, Popov VL, Weaver SC, Beasley DW, Tesh RB: Characterization of CulexFlavivirus (Flaviviridae) strains isolated from mosquitoes in the United States and Trinidad. Virology 2009,386(1):154–159.PubMedView Article
                      9. Morales-Betoulle ME, Monzon Pineda ML, Sosa SM, Panella N, Lopez MR, Cordon-Rosales C, Komar N, Powers A, Johnson BW: Culexflavivirus isolates from mosquitoes in Guatemala. J Med Entomol 2008,45(6):1187–1190.PubMedView Article
                      10. Farfan-Ale JA, Lorono-Pino MA, Garcia-Rejon JE, Hovav E, Powers AM, Lin M, Dorman KS, Platt KB, Bartholomay LC, Soto V, et al.: Detection of RNA from a novel West Nile-like virus and high prevalence of an insect-specific flavivirus in mosquitoes in the Yucatan Peninsula of Mexico. Am J Trop Med Hyg 2009,80(1):85–95.PubMed
                      11. Saiyasombat R, Dorman KS, Garcia-Rejon JE, Lorono-Pino MA, Farfan-Ale JA, Blitvich BJ: Isolation and sequence analysis of Culexflavivirus from Culex interrogator and Culexquinquefasciatus in the Yucatan Peninsula of Mexico. Arch Virol 2010,155(6):983–986.PubMedView Article
                      12. Cook S, Moureau G, Harbach RE, Mukwaya L, Goodger K, Ssenfuka F, Gould E, Holmes EC, de Lamballerie X: Isolation of a novel species of flavivirus and a new strain of Culexflavivirus (Flaviviridae) from a natural mosquito population in Uganda. J Gen Virol 2009,90(Pt 11):2669–2678.PubMedView Article
                      13. Wang H, Li Y, Liang X, Liang G: Japanese encephalitis in mainland china. Jpn J Infect Dis 2009,62(5):331–336.PubMed
                      14. Gao X, Nasci R, Liang G: The neglected arboviral infections in mainland China. PLoS Negl Trop Dis 2010,4(4):e624.PubMedView Article
                      15. Wang ZS AS, Wang Y, Han R, Guo JQ: A new virus of flavivirus: Chaoyang virus isolated in Liaoning province. Chin J Public Health 2009,25(7):3.
                      16. Lu BL: Identification of mosquitoes. In Classification and Identification of Important Medical Insects of China. Edited by: Lu, BL, Wu, YH. Zhengzhou: Henan Science and Technology Publishing House; 2003:12–105. in Chinese
                      17. Li WJ, Wang JL, Li MH, Fu SH, Wang HY, Wang ZY, Jiang SY, Wang XW, Guo P, Zhao SC, et al.: Mosquitoes and mosquito-borne arboviruses in Qinghai-Tibet Plateau-Focus on the Qinghai area, China. Am J Trop Med Hyg 2010,82(4):705–711.PubMedView Article
                      18. Liang GD, He Y, Chen BQ, Zhao ZJ, Huang YJ, Chen L: Preparation of arbovirus group-specific PcAb and their use to identify newly isolated virus strains. Zhonghua Shi Yan He Lin Chuang Bing Du Xue Za Zhi 1993,7(4):374–376. in Chinese
                      19. Thompson JD, Gibson TJ, Higgins DG: Multiple sequence alignment using ClustalW and ClustalX. Curr Protoc Bioinformatics 2002., Chapter 2: Unit 2 3
                      20. Guindon S, Delsuc F, Dufayard JF, Gascuel O: Estimating maximum likelihood phylogenies with PhyML. Methods Mol Biol 2009, 537:113–137.PubMedView Article
                      21. Pybus OG, Rambaut A, Holmes EC, Harvey PH: New inferences from tree shape: numbers of missing taxa and population growth rates. Syst Biol 2002,51(6):881–888.PubMedView Article

                      Copyright

                      © Huanyu et al; licensee BioMed Central Ltd. 2012