Genomic sequencing and analyses of HearMNPV—a new Multinucleocapsid nucleopolyhedrovirus isolated from Helicoverpa armigera

  • Ping Tang1, 2,

    Affiliated with

    • Huan Zhang3,

      Affiliated with

      • Yinü Li1,

        Affiliated with

        • Bin Han1,

          Affiliated with

          • Guozeng Wang1,

            Affiliated with

            • Qilian Qin3Email author and

              Affiliated with

              • Zhifang Zhang1Email author

                Affiliated with

                Virology Journal20129:168

                DOI: 10.1186/1743-422X-9-168

                Received: 17 February 2012

                Accepted: 14 August 2012

                Published: 22 August 2012

                Abstract

                Background

                HearMNPV, a nucleopolyhedrovirus (NPV), which infects the cotton bollworm, Helicoverpa armigera, comprises multiple rod-shaped nucleocapsids in virion(as detected by electron microscopy). HearMNPV shows a different host range compared with H. armigera single-nucleocapsid NPV (HearSNPV). To better understand HearMNPV, the HearMNPV genome was sequenced and analyzed.

                Methods

                The morphology of HearMNPV was observed by electron microscope. The qPCR was used to determine the replication kinetics of HearMNPV infectious for H. armigera in vivo. A random genomic library of HearMNPV was constructed according to the “partial filling-in” method, the sequence and organization of the HearMNPV genome was analyzed and compared with sequence data from other baculoviruses.

                Results

                Real time qPCR showed that HearMNPV DNA replication included a decreasing phase, latent phase, exponential phase, and a stationary phase during infection of H. armigera. The HearMNPV genome consists of 154,196 base pairs, with a G + C content of 40.07%. 162 putative ORFs were detected in the HearMNPV genome, which represented 90.16% of the genome. The remaining 9.84% constitute four homologous regions and other non-coding regions. The gene content and gene arrangement in HearMNPV were most similar to those of Mamestra configurata NPV-B (MacoNPV-B), but was different to HearSNPV. Comparison of the genome of HearMNPV and MacoNPV-B suggested that HearMNPV has a deletion of a 5.4-kb fragment containing five ORFs. In addition, HearMNPV orf66, bro genes, and hrs are different to the corresponding parts of the MacoNPV-B genome.

                Conclusions

                HearMNPV can replicate in vivo in H. armigera and in vitro, and is a new NPV isolate distinguished from HearSNPV. HearMNPV is most closely related to MacoNPV-B, but has a distinct genomic structure, content, and organization.

                Keywords

                Baculovirus Helicoverpa armigera Multinucleocapsid nucleopolyhedrovirus Genome sequence comparison

                Background

                Members of the family Baculoviridae are rod-shaped viruses with circular, covalently closed, double-stranded DNA genomes [1]. This family includes four genera: Alphabaculovirus (lepidopteran-specific nucleopolyhedroviruses (NPVs)), Betabaculovirus (lepidopteran-specific granuloviruses), Gammabaculovirus (hymenopteran-specific NPVs) and Deltabaculovirus (dipteran-specific NPVs) [2]. To date, 54 baculovirus genomes have been sequenced ( http://​www.​ncbi.​nlm.​nih.​gov/​genomes/​GenomesGroup.​cgi?​taxid=​10442), including 37 from Alphabaculovirus, 13 from Betabaculovirus, three from Gammabaculovirus and one from Deltabaculovirus. Nucleopolyhedrovirus (NPV) and granulovirus (GV) are distinguished from each other by their occlusion body morphology. The NPVs produce large, polyhedron-shaped occlusion bodies, called polyhedra, which contain many virions, whereas the GVs have smaller occlusion bodies, called granules, which normally contain a single virion. The NPVs are further designated as single-nucleocapsid (S) or multinucleocapsid (M), depending on the potential number of nucleocapsids packaged in an envelope of the virion.

                The cotton bollworm, H. armigera, is a serious pest that causes economic losses to over 60 vegetable and field crops throughout the world [3]. H. armigera larvae are significantly resistant to chemical insecticides; therefore, baculovirus pesticides have been recognized as one of the most promising agents to control such pests [4]. HzSNPV was registered as one of the first commercial baculovirus pesticides (Virion-H, Biocontrol-VHZ, Elcar) in the 1970s, and has been used extensively to control the cotton bollworm in the USA [5]. HearSNPV was also the first commercial baculovirus pesticide used to control H. armigera in China, and has been extensively used for the control of the pests in vegetable crops [6].

                The DNA genomes of HearSNPV-G4 [7], HearSNPV-C1 [8], HearNPV-NNg1 [9], and HzSNPV [10] have been sequenced. Among them, the HearSNPV-G4 and HearSNPV-C1 were isolated from China, HearNPV-NNg1was isolated from Kenya, and HzSNPV was isolated from the United States. Comparative genomic analyses showed that overall gene content and arrangement in these four viruses were highly conserved, and they are considered variants of the same NPV species [9]. In addition, the nucleotide sequence of the HearGV DNA genome was reported [11]. Multinucleocapsid NPVs isolated from H. armigera (HearMNPV) producing ODV virions with multiple nucleocapsids per envelope have been identified [12, 13]. The genes of other 18 HearMNPV isolates from H. armigera which included lef-8, lef-9, polyhedrin have been reported [14].

                In this study, a new nucleopolyhedrovirus isolated from H.armigera was observed by electron microscope (EM), suggesting it was multinucleocapsid NPV. Experimental infection of insect larvae indicated that host range of HearMNPV was different from that of HearSNPV and that the cytopathological effect of HearMNPV differed from that of HearSNPV. This report describes the sequence and organization of the HearMNPV genome and compares it with sequence data from other baculoviruses, such as HearSNPV and MacoNPV-B.

                Methods

                Viruses and insects

                HearMNPV was originally isolated from a naturally infected H. armigera in the Shanghai city, China in the 1970s. The virus was propagated in laboratory stocks of healthy third instar H. armigera larvae by per os infection. A laboratory stock of eastern armyworm, cotton leaf worm and beet armyworm were reared at 26°C with a 16:8 h light:dark cycle on a semi-synthetic diet.

                Virus purification, DNA extraction, and construction of genomic DNA libraries

                To generate a large number of polyhedra, healthy third instar H. armigera larvae were inoculated and the hemolymph was collected from the H. armigera larvae were collected on ice and centrifuged for 10 min at 4°C. The precipitate was washed several times with distilled water and re-suspended in 0.1% SDS for 30 min at room temperature. After centrifugation, the clean polyhedra were re-suspended in 200 μl TE buffer (10 mM Tris–HCl, pH 8.0, 1 mM EDTA) [15].

                The genomic DNA of HearMNPV was purified according to the following protocol: about 5 × 108 polyhedra were dissolved in 0.1 M Na2CO3, 0.15 M NaCl, pH10.4 on ice for 10 minutes, SDS was then added to a final concentration of 0.5%, and the solution was kept on the ice for another 10 minutes. The genomic DNA was extracted twice in an equal volume phenol (pH8.0) and once in chloroform. The DNA was precipitated with two volumes ethanol, washed with 70% ethanol, and dissolved in 0.1 × TE buffer (pH8.0) [16]. The quantity and quality of the isolated DNA were determined by spectrophotometrically and by electrophoresis on 0.7% agarose.

                A random genomic library of HearMNPV was constructed according to the “partial filling-in” method and contained 2.0 to 5.0 kbp fragment in vector pUC19 [15, 16] DNA fragments for sequencing were prepared from 527 recombinant plasmids. The recombinant plasmids were sequenced with plasmid specific primers and 'primer nesting' from both strands, using BigDye Terminator v3.1 (ABI) on a 3130XL Genetic analyzer (ABI). The combined sequence was generated from these clones represented a six-fold genomic coverage. The gaps were filled by PCR.

                The insect cell lines and infection

                The Hz-AM1 cell line and HaBacHZ8-GFP were gifts from Dr. Fei Deng of Wuhan Institute of Virology, Chinese Academy of Sciences. HaBacHZ8 is a bacmid of HearNPV that lacks the polyhedrin gene. An enhanced GFP gene was introduced to HaBacHZ8 by using the HearSNPV bac-to-bac system [17, 18] and this generated the bacmid HaBacHZ8–GFP [19]. The QB-Ha-E-5 cell line, which was a gift from Dr. Guiling Zheng of Shandong Agricultural University, was established from the embryonic tissue of H. armigera (Lepidoptera: Noctuidae). The cell line had been subcultured over 60 passages in TNM-FH medium supplemented with 10% fetal bovine serum. The cell line could be infected by H. arigera single nucleopolyhedrovirus (HaSNPV) [20]. The Hz-AM1 cells and QB-Ha-E-5 cells were cultured at 27°C in TNM-FH insect medium (Sigma, USA) supplemented with 10% (v/v) heat-inactivated fetal bovine serum (Gibco-BRL, Gaithersburg, USA). Hz-AM1cells and QB-Ha-E-5 cells were infected with HearMNPV at a multiplicity of infection (MOI) of 5. For coinfection, QB-Ha-E-5 cells were infected simultaneously with HearMNPV and HaBacHZ8-GFP at an MOI of 5 for each virus. The cells were examined using Nikon-Ts100 and Leica TCS SP5 II microscopes.

                Scanning electron microscopy

                Polyhedra were fixed in 2.5% glutaraldehyde at 4°C for 2 h. The fixed sample was dehydrated through a serial ethanol gradient, and then embedded in Epon-Araldite resin. A diamond knife was used to cut ultrathin sections on a Reichert OMU3 Ultramicrotome. The sections were stained with 2% aqueous uranyl acetate, followed by lead citrate. Micrographs of the Polyhedra were taken with a Hitachi S3400N transmission electron microscope at 80 kV.

                Transmission electron microscopy

                Polyhedra were fixed in 2.5% glutaraldehyde in 0.05 cacodylate buffer at 4°C for 2 h and post-fixed in 1% osmium tetroxide in the same buffer for 2 h at room temperature. Fixed samples were dehydrated through a graded series of ethanol solutions and embedded in Spurr’s resin. Sections were cut, stained with uranyl acetate and lead citrate, and examined under a JEM-1230 transmission electron microscope (TEM) at an accelerating voltage of 80 kV.

                Quantitative PCR (qPCR)

                Third-instar larvae were starved for 12 h at 26°C before being inoculated, and H. armigera test larvae were allowed to ingest a diet soaked in a 10 μl drop, containing an estimated 107 OBs. Control larvae ingested a diet soaked in a 10 μl drop with no OBs. The diet soaked OBs or ddH2O were replaced by fresh diet with no OBs after 2 hours adsorption period at 26°C. Time zero of the infection was defined as the time when the diet soaked OBs or ddH2O was removed from the culture boxes. Larvae used in this experiment were sacrificed at various time points ranging from 4 to 96 h post-inoculation (p.i.). A powder was prepared from ten larvae using a mortar and pestle after each collection under liquid nitrogen. 0.1MNa2CO3, 0.15 M NaCl, 1%NP-40 was added to the powders to a total volume of 700 μl. Total DNA was then extracted by the addition of an equal volume of phenol (pH8.0) (twice) and chloroform (once). The DNA was precipitated with two volumes of ethanol, washed with 70% ethanol, and dissolved in ddH2O. The quantity and quality of the isolated DNAs were determined spectrophotometrically.

                HearMNPV DNA copy number was determined by real-time qPCR with primers specific to the rr2b gene. The viral copy number was then normalized against host-genome copy number by qPCR with primers specific to the host actin gene [21]. The rr2b and actin genes were amplified by PCR and cloned into pGEM-T. Recombinant plasmid DNA concentrations were quantified using a spectrophotometer and dilution standards were generated. For each standard dilution, three independent qPCRs were performed using rr2b or actin specific primers, and standard curves were generated. For each larval DNA extract, three independent qPCRs were performed using rr2b and actin specific primers. The mean of the HearMNPV DNA copy numbers were determined and the number of rr2b amplicons was normalized against the number of host actin genes to derive the mean number of viral copies per mean host actin gene copy number. The specific primers were as follows:
                • actin-F 5' CTCTTCCAGCCCTCATTCTTG 3'

                • actin -R 5' TTCTGCATACGGTCAGCGATA 3'

                • rr2b-F 5' AGCAACAAGACTTAATACTCAACGC 3'

                • rr2b-R 5' AATATGGCTGCAAAGCTACCG 3'

                DNA sequence analysis

                Restriction fragments from recombinant plasmids were sequenced and assembled into contigs using SeqMan5.0 from the DNASTAR software package. PCR was used to generate gap-spanning fragments and low quality data regions after preliminary assembly. Open reading frames (ORFs) were identified using ORF Finder http://​www.​ncbi.​nlm.​nih.​gov/​gorf/​gorf.​html[22]. The criterion for defining an ORF was a size of at least 150 nt (50 aa) with minimal overlap. Promoter motifs present upstream of the putative ORFs were screened as described previously [23]. Homology searches were done through the National Centre for Biotechnology Information (NCBI) website using BLAST [24]. Multiple alignments and percentage identities were performed using the Clustal W. The Tandem Repeats Finder http://​tandem.​bu.​edu/​trf/​trf.​html was used to locate and analyze the homologous regions (hrs) [25]. GeneParityPlot analysis was performed as described previously [26]. A phylogenetic tree was inferred from amino acid sequences by NJ and MP analyses using MEGA, version 5.0 [27]. Bootstrap analyses were performed to evaluate the robustness of the phylogenies using 1000 replicates for both NJ and MP analyses.

                Results and discussion

                Electron microscopy observation

                Scanning electron microscopy revealed that the purified occlusion bodies (OBs) of NPV originating from infected cotton bollworm have irregular shapes, with diameters of about 2 ± 0.3 μm (Figure 1A). Transmission electron microscopy showed multiple rod-shaped nucleocapsids of about 230 nm in length and 50 nm in width embedded in each OB, with multiple nucleocapsids packaged within the envelope of the virion (Figure 1B). These results indicated that the virus is a typical multinucleocapsid NPV. However, transmission electron microscopy indicated that HearSNPV have single nucleocapsids packaged in their virion (Figure 1C). Therefore, the isolate was termed H. armigera multinucleocapsid nucleopolyhedrovirus (HearMNPV).
                http://static-content.springer.com/image/art%3A10.1186%2F1743-422X-9-168/MediaObjects/12985_2012_1945_Fig1_HTML.jpg
                Figure 1

                Electron micrographs of polyhedra from HearMNPV and HearSNPV. A. Scanning electron micrograph of HearMNPV (12,000×) B. Transmission electron micrograph of HearMNPV (80,000×) C. Transmission electron micrograph of HearSNPV (20,000×).

                HearMNPV infected insect larvae and cells

                Experimental infection of insect larvae showed that HearMNPV can infect the eastern armyworm (Pseudaletia separate), but cannot infect either the cotton leaf worm (Spodoptera litura) or the beet armyworm (Spodoptera exigua). By contrast, HearSNPV cannot infect P. separate. These results indicate that the host range of HearMNPV differs from that of HearSNPV. Moreover, HearMNPV-infected Hz-AM1 cells produced no polyhedra and showed no typical cytopathic effects (CPE), even at 96 h post-infection (pi) (Figure 2A). However, HearMNPV-infected QB-Ha-E-5 cells produced polyhedra (Figure 2B). It was previously reported that Hz-AM1 cells were permissive to HearSNPV-G4 [8, 17, 18]. When QB-Ha-E-5 cells were infected by HaBacHZ8-GFP [18, 19], which was constructed from HearSNPV, green fluorescence was observed under fluorescence microscopy (Figure 2C). These results indicate that the host range and cells infected by HearMNPV differ from those infected by HearSNPV.
                http://static-content.springer.com/image/art%3A10.1186%2F1743-422X-9-168/MediaObjects/12985_2012_1945_Fig2_HTML.jpg
                Figure 2

                Cytopathic effects in infected cells. Panel A: Hz-AM1 cells uninfected (A) and infected with HearMNPV (MOI:5) at 72 hpi (B). Panel B: QB-Ha-E-5 cells uninfected (C) and infected with HearMNPV (MOI:5) at 72 hpi (D). Panel C: QB-Ha-E-5 cells co-infected with HearMNPV and HaBacHZ8-GFP (MOI:5) at 72 hpi. Cells were viewed using confocal laser fluorescence microscopy. Arrows 1 and 2 indicate polyhedra-containing fluorescent cells, arrow 3 indicates polyhedra-containing cells, and arrow 4 indicates fluorescent cells. Magnification: ×400.

                Coinfection of QB-Ha-E-5 cells with HaBacHZ8-GFP and HearMNPV showed that certain cells possessed green fluorescence (under fluorescence microscopy), some cells produced polyhedra, and some cells possessed both green fluorescence and polyhedra (Figure 2C). The results indicate in cells coinfected with two distinct viruses, the viruses are able to coexist, replicate, and package themselves independently. Cydia pomonella granulovirus (CpGV) is one of the most successful commercial baculovirus insecticides; however, resistance of the codling moth (C. pomonella) to commercially applied CpGV in orchards located in Germany and France has occurred [28]. Therefore, alternating virus treatment or using a mix of HearMNPV and HearSNPV could delay the development of resistance in H. armigera, helping to improve both the prevention and control of H. armigera in the field.

                HearMNPV virus DNA replication in vivo

                HearMNPV is a potentially new isolate infectious for H. armigera based on the analysis of host range and morphology. Thus qPCR was used to determine the replication efficiency of HearMNPV infectious for H. armigera in vivo. Figure 3 shows the quantity of HearMNPV viral DNA in infected larvae, in the decreasing phase (0–4 hr), latent phase (4–12 h), exponential phase (12–48 h), and stationary phase (48–96 h). Initially, the number of viral DNA (vDNA) copies appeared to decrease between 0 h post infection (p.i.) and 4 h p.i. before increasing by 6.97 times between 4 h p.i. and 12 h p.i. The number of vDNA dramatically increased between 12 h p.i. and 48 h p.i., from 452/105 actin to 2.02 × 1011/105 actin, an increase of 4.46 × 108 fold. These results indicated that the viral DNA replicated about 29 times, taking about 1.24 h to generate another vDNA copy. This trend continued into the stationary phase, to a lesser degree: vDNA increased 4.82 times between 48 h p.i. and 96 h p.i, and there were about1.17 × 1012 copies per 105 actin at 96 h. These results suggested that H. armigera could be infected by HearMNPV efficiently and the replication kinetics conformed what has previously been described for other baculoviruses [29].
                http://static-content.springer.com/image/art%3A10.1186%2F1743-422X-9-168/MediaObjects/12985_2012_1945_Fig3_HTML.jpg
                Figure 3

                Quantification of HearMNPV DNA copy number in infected H. armigera larvae. qPCR was used to determine the number of rr2b gene copies relative to the actin gene at various times following infection. The plotted points indicate the averages of the number rr2b gene copies relative to actin gene (performed in triplicate).Error bars represent standard deviations.

                Nucleotide sequence of the HearMNPV genome

                The HearMNPV genome consists of 154,196 bp (GenBank accession no. NC_011615), which is similar to the genomes of MacoNPV-A (155,060 bp) and MacoNPV-B (158,482 bp). The HearMNPV genome has a G + C content of 40.07%, which is within the 58% (LdMNPV) and 32.7% (ChocGV) range for baculovirus genomes, and is similar to MacoNPV-B (40%), AcMNPV (40.7%), BmNPV (40.4%), and EppoNPV (40.7%). According to the adopted convention, the adenine residue at the translation initiation codon of the polyhedrin gene represented the zero point on the HearMNPV physical map, and the polyhedrin gene was designated as ORF 1 (Table 1). A total of 162 putative ORFs and four homologous regions (hrs) were detected in the HearMNPV genome, using computer-assisted analysis to select ORFs starting from a methionine-initiated codon (ATG) and including at least 50 amino acids (aa) and having a minimal overlap with other ORFs [30, 31]. All 162 ORFs are shown in Table 1 by location, orientation, size, and potential baculovirus homologs.
                Table 1

                List of ORFs in HearMNPV and their Homologous ORFs in the MacoNPV-B, MacoNPV-A, HearSNPV(G4), AcMNPV, AgSeNPV and HearGV

                ORF

                Name

                Positiona

                Prmb

                length

                Homologous ORFs [ORF number,amino acid identity(%)]

                MacoNPV-B

                MacoNPV-A

                HearSNPV(G4)

                AcMNPV

                AgSeNPV

                HearGV

                1

                polh

                1

                >

                741

                L

                246

                1

                100

                1

                98.0

                1

                87.4

                8

                89.3

                1

                89.8

                1

                55.1

                2

                1629

                790

                <

                2358

                L

                522

                2

                95.8

                2

                72.3

                2

                26.6

                9

                27.9

                2

                33.0

                2

                16.7

                3

                pk1

                2357

                >

                3175

                 

                272

                3

                99.6

                3

                87.5

                3

                48.5

                10

                38.7

                3

                58.6

                3

                34.6

                4

                hoar

                3250

                <

                5478

                E

                742

                4

                97.1

                4

                74.3

                4

                20.2

                  

                4

                27.7

                  

                5

                 

                5967

                >

                6533

                E

                188

                5

                96.8

                5

                67.2

                        

                6

                odv-e56

                6626

                >

                7747

                L

                373

                6

                100

                6

                89.3

                15

                52.6

                148

                49.2

                6

                59.5

                14

                42.1

                7

                me53

                7892

                <

                8956

                 

                354

                7

                99.7

                7

                86.2

                16

                30.9

                139

                24.6

                7

                47.4

                178

                22.1

                8

                F protein

                9563

                >

                11599

                L

                678

                8

                99.9

                9

                90.9

                133

                36.9

                23

                22.1

                8

                44.4

                26

                29.8

                9

                 

                11719

                <

                12678

                E

                319

                9

                99.1

                10

                91.2

                    

                9

                46.1

                  

                10

                gp16

                12729

                <

                13016

                L

                95

                10

                100

                11

                97.9

                119

                30.8

                130

                35.5

                10

                65.6

                  

                11

                p24

                13029

                <

                13718

                L

                229

                11

                100

                12

                92.5

                118

                50.4

                129

                37.4

                11

                63.8

                78

                25.7

                12

                 

                13784

                >

                14095

                L

                103

                12

                100

                13

                91.3

                117a

                34.6

                  

                12

                44.4

                  

                13

                lef2

                14049

                >

                14696

                 

                215

                13

                99.1

                14

                82.0

                117

                47.9

                6

                40.6

                13

                56.6

                33

                26.8

                14

                xe

                14792

                >

                15175

                E

                127

                14

                99.2

                15

                85.5

                      

                21

                22.0

                 

                hr1

                15251

                 

                16435

                              

                15

                endonuclease

                16436

                <

                16732

                L

                98

                15

                99.0

                17

                93.4

                  

                79

                44.7

                  

                69

                40.5

                16

                 

                16798

                >

                17397

                 

                199

                16

                98.5

                18

                87.9

                  

                70

                23.9

                25

                27.0

                  

                17

                 

                17550

                >

                18260

                E,L

                236

                117

                41.2

                19

                80.6

                  

                151

                33.0

                103

                38.9

                  

                18

                chitinase

                18318

                <

                20006

                L

                562

                19

                99.3

                22

                97.0

                41

                63.3

                126

                67.2

                23

                82.6

                105

                60.3

                19

                bro-a

                20197

                >

                21192

                 

                331

                20

                83

                24

                77.7

                60

                53.9

                2

                23.3

                50

                33.2

                101

                64.3

                20

                 

                21257

                >

                21682

                E

                141

                21

                99.3

                25

                86.5

                      

                131

                38.9

                21

                 

                21786

                >

                22595

                E

                269

                22

                98.1

                26

                78.1

                      

                52

                40.8

                22

                 

                22706

                <

                23347

                 

                213

                23

                95.8

                27

                91.1

                57

                25.8

                  

                49

                21.4

                81

                34.9

                23

                 

                23525

                >

                23839

                L

                104

                24

                99.0

                29

                64.4

                        

                24

                 

                23960

                <

                24595

                E

                211

                25

                97.6

                30

                69.2

                        

                25

                hel2

                25012

                <

                26379

                E

                455

                26

                98.9

                        

                147

                57.7

                26

                he65

                26512

                <

                28266

                 

                584

                27

                98.5

                32

                91.7

                61

                28.6

                105

                37.1

                20

                53.3

                62

                53.4

                27

                cathepsin

                28331

                >

                29356

                 

                341

                28

                100

                33

                97.1

                56

                46.7

                127

                56.9

                19

                81.3

                  

                28

                 

                29353

                <

                29700

                L

                115

                29

                100

                34

                90.6

                125

                29.0

                  

                18

                72.0

                  

                29

                lef1

                29728

                >

                30375

                 

                215

                30

                99.1

                35

                95.8

                124

                48.2

                14

                40.0

                17

                64.2

                80

                36.6

                30

                38.7 k

                30375

                >

                31424

                L

                349

                31

                99.7

                36

                92.6

                123

                34.1

                13

                29.5

                16

                60.3

                102

                23.4

                31

                gp37

                31476

                >

                32264

                L

                262

                32

                99.6

                37

                95.0

                58

                62.8

                64

                58.6

                26

                72.4

                109

                43.1

                32

                ptp2

                32221

                <

                32760

                L

                179

                33

                98.9

                38

                92.7

                    

                27

                51.0

                  

                33

                egt

                32828

                >

                34414

                E

                528

                34

                99.4

                39

                94.4

                126

                50.7

                15

                48.0

                28

                73.1

                  

                34

                 

                34583

                >

                35119

                E

                178

                35

                98.9

                40

                94.9

                127

                22.3

                  

                29

                53.3

                  

                35

                 

                35119

                >

                35766

                 

                215

                36

                98.1

                41

                90.7

                128

                28.1

                17

                30.4

                30

                45.9

                  

                36

                 

                35802

                <

                38357

                 

                851

                37

                99.4

                42

                88.5

                129

                26.5

                  

                31

                45.4

                  

                37

                chtB2

                38415

                >

                38855

                L

                146

                38

                98.6

                43

                64.6

                83

                31.7

                146

                43.8

                148

                34.0

                107

                46.2

                38

                 

                38886

                >

                39413

                L

                175

                39

                99.4

                44

                82.8

                  

                4

                26.7

                32

                36.8

                  

                39

                pkip

                39434

                >

                39943

                L

                169

                40

                100

                45

                91.6

                130

                36.2

                24

                23.5

                33

                55.6

                  

                40

                 

                39965

                <

                40306

                 

                113

                41

                100

                46

                96.5

                    

                34

                52.7

                  

                41

                arif1

                40312

                <

                41184

                 

                290

                42

                98.6

                47

                92.0

                131

                29.2

                21

                22.7

                35

                43.3

                  

                42

                pif2

                40940

                >

                42199

                 

                419

                43

                99.3

                48

                95.0

                132

                69.0

                22

                59.5

                36

                74.6

                42

                51.1

                43

                pif1

                42214

                >

                43803

                 

                529

                44

                99.6

                49

                93.6

                111

                43.0

                119

                48.6

                37

                61.2

                82

                36.2

                44

                 

                43800

                >

                44045

                 

                81

                45

                100

                50

                96.3

                112

                32.9

                  

                38

                44.3

                  

                45

                fgf

                44080

                <

                45174

                 

                364

                46

                99.2

                51

                72.9

                113

                32.0

                32

                27.5

                39

                41.7

                176

                34.0

                46

                 

                45210

                >

                46115

                 

                301

                47

                99.7

                53

                89.5

                    

                40

                45.7

                  

                47

                alk-exo

                46157

                <

                47344

                L

                395

                48

                99.8

                54

                90.1

                114

                41.4

                133

                38.8

                41

                48.6

                146

                39.4

                48

                 

                47582

                <

                47920

                L

                112

                49

                100

                55

                93.6

                115

                27.0

                19

                26.7

                44

                65.1

                  

                49

                 

                47919

                >

                49082

                L

                387

                50

                99.7

                56

                94.6

                  

                18

                25.8

                45

                62.3

                  

                50

                 

                49121

                <

                49522

                 

                133

                51

                99.3

                57

                94.7

                122

                22.5

                132

                21.9

                46

                50.0

                  

                51

                rr2

                49594

                >

                50535

                 

                313

                52

                99.7

                58

                94.3

                    

                47

                72.2

                  

                52

                 

                50544

                <

                51593

                 

                349

                53

                100

                59

                73.1

                    

                103

                55.3

                  

                53

                calyx/pep

                51620

                <

                52597

                 

                325

                61

                100

                60

                97.5

                120

                41.6

                131

                32.3

                49

                65.7

                18

                21.0

                54

                 

                52871

                <

                53209

                 

                112

                62

                100

                62

                84.1

                110

                40.2

                117

                34.2

                51

                66.0

                  

                55

                 

                53161

                <

                53523

                E

                120

                63

                100

                63

                90.8

                109

                35.8

                  

                52

                53.2

                  

                56

                 

                53687

                <

                54301

                E,L

                204

                64

                98.5

                65

                86.8

                        

                57

                sod

                54366

                <

                54821

                 

                151

                65

                100

                66

                96.7

                106

                75.3

                31

                73.2

                54

                85.2

                63

                53.7

                58

                 

                54878

                >

                55243

                 

                121

                66

                100

                67

                86.8

                    

                55

                47.3

                  

                59

                pif3

                55269

                >

                55880

                L

                203

                67

                98.0

                68

                92.6

                98

                51.8

                115

                47.1

                56

                70.0

                30

                44.5

                60

                 

                55846

                >

                56316

                 

                156

                68

                98.1

                69

                87.7

                99

                22.7

                  

                57

                57.5

                  

                61

                pagr

                56365

                >

                57819

                L

                484

                69

                99.4

                70

                87.4

                100

                23.5

                  

                58

                38.0

                  

                62

                 

                57842

                >

                58483

                L

                213

                70

                100

                71

                96.8

                101

                57.1

                106

                53.2

                59

                78.2

                45

                44.1

                63

                nrk1

                58518

                <

                59627

                E

                369

                71

                99.4

                72

                95.0

                  

                33

                30.1

                60

                58.4

                  
                 

                hr2

                59758

                 

                61523

                              

                64

                 

                61569

                >

                62045

                L

                158

                72

                93.7

                73

                87.3

                  

                4

                25.6

                32

                20.2

                  

                65

                dutpase

                62105

                >

                62449

                E

                114

                73

                91.2

                74

                92.2

                    

                62

                66.7

                  

                66

                 

                62531

                >

                64309

                E,L

                592

                18

                99

                        

                53

                51.0

                67

                bro-b

                64565

                >

                65572

                 

                335

                74

                77.5

                75

                79.6

                60

                47.5

                2

                23.0

                50

                32.0

                101

                54.8

                68

                p13

                65621

                >

                66457

                L

                278

                75

                99.6

                76

                95.3

                97

                58.4

                  

                64

                68.5

                40

                47.4

                69

                sprT

                66512

                >

                67036

                 

                174

                76

                98.9

                77

                89.7

                      

                21

                30.7

                70

                odv-e66a

                67148

                >

                69166

                E,L

                672

                77

                99.7

                78

                97.2

                96

                58.1

                46

                39.7

                125

                35.9

                150

                56.3

                71

                 

                69163

                <

                69474

                L

                103

                78

                99.0

                79

                96.1

                95

                44.7

                108

                32.8

                65

                59.6

                  

                72

                odv-ec43

                69484

                <

                70554

                L

                356

                79

                100

                80

                95.2

                94

                50.4

                109

                41.6

                66

                77.3

                48

                31.9

                73

                 

                70538

                <

                70717

                 

                59

                80

                100

                81

                98.3

                93

                50.0

                110

                36.0

                67

                73.7

                46

                50.0

                74

                vp80

                70714

                <

                72360

                 

                548

                81

                99.3

                82

                83.1

                92

                24.0

                104

                22.9

                68

                37.2

                  

                75

                p45

                72388

                >

                73521

                E,L

                377

                82

                99.7

                83

                97.9

                91

                58.7

                103

                51.1

                69

                80.7

                90

                39.5

                76

                p12

                73508

                >

                73816

                L

                102

                83

                100

                84

                89.2

                90

                42.1

                102

                32.6

                70

                51.9

                  

                77

                p40

                73842

                >

                74936

                L

                364

                84

                100

                85

                92.6

                89

                53.1

                101

                43.4

                71

                69.6

                92

                21.6

                78

                p6.9

                74995

                >

                75228

                L

                77

                85

                100

                86

                83.3

                88

                58.9

                100

                62.0

                72

                64.2

                93

                16.7

                79

                lef5

                75225

                <

                76046

                 

                273

                86

                99.6

                87

                96.3

                87

                50.3

                99

                57.4

                73

                77.6

                94

                43.0

                80

                38 k

                75945

                >

                76847

                L

                300

                87

                99.7

                88

                96.0

                86

                53.7

                98

                44.6

                74

                73.0

                95

                40.5

                81

                vef

                76886

                >

                79432

                L

                848

                88

                99.3

                89

                81.3

                    

                76

                39.5

                151

                28.4

                82

                bro-c

                79437

                <

                80507

                 

                356

                89

                98.3

                90

                84.4

                105

                28.9

                2

                50.1

                77

                63.7

                117

                25.1

                83

                 

                80591

                <

                81019

                 

                142

                90

                99.3

                91

                95.8

                    

                78

                72.5

                  

                84

                odv-e28

                81052

                <

                81570

                 

                172

                91

                98.84

                92

                97.7

                85

                62.9

                96

                50.6

                79

                80.2

                96

                40.5

                85

                helicase

                81527

                >

                85156

                L

                1209

                92

                99.83

                93

                96.5

                84

                46.8

                95

                41.8

                80

                78.7

                97

                27.8

                86

                odv-e25

                85256

                <

                85906

                L

                216

                93

                100

                94

                94.9

                82

                64.5

                94

                45.1

                81

                83.9

                98

                48.0

                87

                 

                85903

                <

                86388

                L

                161

                94

                100

                95

                98.8

                81

                69.7

                93

                51.0

                82

                88.4

                99

                32.9

                88

                 

                86387

                >

                87145

                 

                252

                95

                99.6

                96

                94.8

                80

                57.5

                92

                51.4

                83

                82.5

                100

                37.9

                89

                 

                87255

                >

                87770

                E,L

                171

                96

                97.7

                97

                91.2

                77

                33.9

                142

                34.7

                84

                31.7

                  

                90

                lef4

                87802

                <

                89166

                 

                454

                97

                99.6

                98

                91.9

                79

                48.4

                90

                44.5

                85

                66.3

                112

                35.3

                91

                vp39

                89165

                >

                90154

                L

                329

                98

                98.5

                99

                79.6

                78

                50.9

                89

                42.1

                86

                55.2

                113

                31.9

                92

                cg30

                90237

                >

                91061

                E

                274

                99

                97.8

                100

                80.8

                77

                21.2

                88

                21.7

                87

                28.6

                  

                93

                91 k

                91117

                <

                93555

                L

                812

                100

                99.3

                101

                92.9

                76

                44.4

                83

                41.5

                88

                58.4

                121

                28.3

                94

                tlp-20

                93524

                >

                94111

                L

                195

                101

                98.0

                102

                91.9

                75

                41.4

                82

                31.4

                89

                63.7

                122

                41.2

                95

                 

                93936

                >

                94658

                L

                240

                102

                99.2

                103

                82.8

                74

                62.3

                81

                49.5

                90

                68.3

                123

                51.5

                96

                gp41

                94627

                >

                95628

                L

                333

                103

                100

                104

                97.9

                73

                55.7

                80

                57.1

                91

                80.4

                124

                36.0

                97

                 

                95508

                >

                95963

                 

                151

                104

                100

                105

                92.2

                72

                41.5

                78

                35.9

                92

                58.3

                  

                98

                vlf-1

                95965

                >

                97107

                L

                380

                105

                100

                106

                97.4

                71

                62.8

                77

                64.0

                93

                90.5

                126

                27.6

                99

                ctl

                97104

                <

                97256

                L

                50

                106

                98

                107

                94.0

                  

                3

                49.0

                  

                130

                65.3

                100

                 

                97329

                <

                98423

                E

                364

                107

                98.1

                108

                82.7

                34

                22.7

                  

                127

                22.5

                  

                101

                p26

                98524

                <

                99258

                E

                244

                108

                100

                109

                97.1

                22

                27.9

                136

                31.6

                94

                66.0

                  

                102

                iap-2

                99307

                <

                100053

                 

                248

                109

                99.2

                110

                87.8

                62

                43.1

                71

                32.8

                95

                57.6

                139

                27.6

                103

                 

                100010

                <

                100825

                 

                271

                110

                98.9

                111

                92.6

                63

                48.5

                69

                45.4

                96

                67.1

                  

                104

                 

                100809

                <

                101174

                 

                121

                111

                100

                112

                95.9

                64

                55.1

                68

                47.9

                97

                75.6

                137

                40.4

                105

                lef3

                101173

                >

                102354

                 

                393

                112

                99.5

                113

                82.2

                65

                30.5

                67

                27.0

                98

                54.3

                  

                106

                desmoplakin

                102414

                <

                104675

                 

                753

                113

                99.2

                114

                79.9

                66

                24.9

                66

                22.3

                99

                29.9

                135

                38.2

                107

                DNA pol

                104674

                >

                107676

                 

                1000

                114

                99.9

                115

                94.3

                67

                59.3

                65

                45.5

                100

                72.5

                134

                38.3

                108

                 

                107710

                <

                108099

                L

                129

                115

                100

                116

                99.2

                69

                40.5

                75

                26.4

                101

                84.5

                  

                109

                 

                108110

                <

                108367

                L

                85

                116

                100

                117

                100.0

                70

                70.6

                76

                41.9

                102

                87.1

                128

                32.9

                110

                 

                108459

                >

                109199

                 

                246

                117

                97.2

                118

                86.0

                  

                151

                61.5

                103

                39.0

                10

                32.9

                111

                 

                109191

                <

                109736

                 

                181

                118

                98.9

                119

                87.9

                57

                31.8

                  

                49

                23.6

                81

                29.5

                112

                 

                109771

                >

                110232

                 

                153

                119

                98.7

                120

                96.1

                        

                113

                 

                110287

                >

                110934

                L

                215

                120

                96.7

                121

                88.8

                    

                104

                46.6

                167

                30.4

                114

                bro-d

                110975

                <

                112033

                 

                352

                121

                89.6

                122

                83.6

                105

                23.4

                2

                45.1

                123

                39.3

                117

                27.9

                115

                bro-e

                112087

                <

                112776

                 

                229

                122

                97.4

                123

                76.5

                59

                25.0

                2

                34.4

                77

                28.4

                133

                34.3

                116

                lef9

                112859

                <

                114352

                L

                497

                123

                99.6

                124

                96.4

                55

                70.2

                62

                64.5

                105

                85.9

                140

                53.5

                117

                fp25

                114430

                >

                115017

                L

                195

                124

                100

                125

                99.0

                53

                71.2

                61

                62.8

                106

                88.7

                141

                33.6

                118

                p94

                115094

                >

                117598

                 

                834

                125

                99.4

                126

                82.5

                  

                134

                41.7

                  

                20

                35.8

                119

                bro-f

                117622

                >

                118161

                L

                179

                126

                98.8

                127

                95.0

                60

                42.3

                  

                107

                64.0

                158

                50.9

                120

                chaB2

                118194

                >

                118469

                L

                91

                127

                100

                128

                96.7

                52

                55.2

                60

                48.8

                108

                67.4

                103

                38.6

                121

                chaB1

                118447

                >

                118956

                 

                169

                128

                94.4

                129

                87.4

                51

                39.0

                59

                49.1

                109

                53.8

                  

                122

                 

                118949

                <

                119428

                E

                159

                129

                98.7

                130

                95.0

                50

                40.3

                57

                37.4

                110

                59.4

                  

                123

                 

                119678

                <

                119947

                L

                89

                130

                100

                131

                92.1

                49

                55.6

                56

                42.9

                111

                60.0

                  

                124

                 

                119889

                <

                120098

                 

                69

                131

                100

                132

                95.8

                48

                49.3

                55

                42.0

                112

                71.6

                  

                125

                vp1054

                120224

                <

                121234

                E,L

                336

                132

                100

                133

                93.2

                47

                53.2

                54

                40.3

                113

                67.3

                173

                35.0

                126

                lef10

                121095

                <

                121322

                L

                75

                133

                98.7

                134

                93.3

                46

                47.2

                53a

                50.7

                114

                62.7

                  

                127

                 

                121282

                >

                121509

                L

                75

                134

                100

                135

                93.3

                45

                36.0

                  

                115

                50.8

                  

                128

                 

                121523

                >

                122509

                L

                328

                135

                97.3

                136

                75.0

                44

                29.0

                  

                116

                34.0

                  

                129

                 

                122514

                <

                122987

                L

                157

                136

                100

                137

                94.3

                43

                57.4

                53

                51.2

                117

                66.9

                169

                28.8

                130

                 

                122986

                >

                123489

                 

                167

                137

                100

                138

                88.6

                42

                26.5

                52

                20.8

                118

                49.1

                  
                 

                hr3

                123528

                 

                124601

                              

                131

                Iap3

                124860

                >

                125717

                L

                285

                138

                99.3

                139

                82.5

                103

                33.2

                27

                28.0

                119

                43.9

                139

                25.5

                132

                bjdp

                125756

                <

                126910

                 

                384

                139

                98.7

                140

                88.0

                39

                31.5

                51

                19.5

                120

                36.6

                  

                133

                lef8

                126931

                >

                129567

                 

                878

                140

                99.9

                141

                97.3

                38

                68.0

                50

                60.5

                121

                78.9

                149

                50.3

                134

                 

                129595

                <

                130059

                 

                154

                141

                98.7

                142

                82.2

                    

                122

                29.7

                  

                135

                 

                130103

                <

                130303

                 

                66

                142

                100

                143

                95.4

                37

                25.4

                43

                32.3

                124

                58.6

                  

                136

                odv-e66b

                130351

                <

                132342

                L

                663

                143

                98.6

                144

                88.8

                96

                33.8

                46

                27.9

                125

                50.2

                150

                35.4

                137

                p47

                132390

                >

                133583

                 

                397

                144

                99.8

                145

                97.2

                35

                61.8

                40

                55.2

                126

                75.6

                74

                46.6

                138

                 

                133594

                <

                134643

                 

                349

                145

                99.1

                146

                85.6

                    

                127

                34.0

                  
                 

                hr4

                134722

                 

                135445

                              

                139

                 

                135447

                <

                135710

                E

                87

                            

                140

                 

                135947

                >

                136519

                E

                190

                146

                98.4

                147

                81.9

                    

                129

                30.8

                  

                141

                bv-e31

                136581

                >

                137285

                E,L

                234

                147

                100

                148

                94.9

                33

                66.5

                38

                63.3

                130

                85.0

                77

                42.4

                142

                lef11

                137210

                >

                137584

                L

                124

                148

                99.2

                149

                90.2

                32

                49.0

                37

                39.1

                131

                64.6

                51

                38.1

                143

                39 k

                137553

                >

                138407

                L

                284

                149

                99.3

                150

                92.0

                31

                30.3

                36

                33.8

                132

                49.8

                50

                30.2

                144

                 

                138476

                <

                138673

                 

                65

                150

                98.5

                151

                86.2

                    

                134

                37.1

                  

                145

                ubiquitin

                138600

                <

                138902

                L

                100

                151

                100

                152

                93.9

                28

                77.6

                35

                77.9

                135

                94.7

                47

                76.6

                146

                 

                138958

                >

                139503

                L

                181

                152

                98.9

                153

                93.4

                27

                50.3

                34

                35.5

                136

                63.8

                  

                147

                 

                139854

                <

                140210

                L

                118

                153

                99.2

                154

                94.9

                26

                36.6

                26

                32.4

                138

                61.1

                  

                148

                dbp-2

                140299

                >

                141279

                E

                326

                154

                99.1

                155

                95.4

                25

                42.8

                25

                24.2

                139

                59.9

                87

                24.0

                149

                lef6

                141285

                >

                141710

                L

                141

                155

                98.6

                156

                93.7

                24

                45.7

                28

                25.5

                140

                47.1

                  

                150

                 

                141751

                <

                141996

                 

                81

                156

                100

                157

                97.5

                  

                29

                41.4

                141

                75.3

                  

                151

                p26

                142112

                >

                142912

                L

                266

                157

                98.9

                158

                96.6

                22

                44.9

                136

                33.1

                142

                67.1

                  

                152

                p10

                142951

                >

                143202

                L

                83

                158

                100

                159

                92.9

                21

                47.1

                137

                35.1

                143

                70.4

                5

                43.4

                153

                p74

                143289

                <

                145262

                L

                657

                159

                99.4

                160

                94.7

                20

                55.3

                138

                52.5

                144

                65.9

                72

                39.3

                154

                 

                145343

                >

                145594

                E,L

                83

                160

                98.8

                161

                91.8

                19

                32.1

                  

                145

                53.0

                  

                155

                ie1

                145631

                <

                147436

                 

                601

                161

                99.3

                162

                91.1

                14

                41.5

                147

                29.4

                146

                47.4

                  

                156

                ep23

                147478

                >

                148053

                L

                191

                162

                100

                163

                95.3

                13

                31.4

                146

                33.5

                147

                63.9

                9

                30.9

                157

                chtB1

                148114

                <

                148392

                L

                92

                163

                100

                164

                92.4

                12

                55.4

                145

                44.2

                148

                70.7

                10

                40.7

                158

                odv-e27

                148395

                <

                149231

                L

                278

                164

                100

                165

                97.5

                11

                59.8

                144

                51.7

                149

                90.7

                114

                27.7

                159

                odv-e18

                149270

                <

                149527

                L

                85

                165

                100

                166

                88.4

                10

                54.1

                143

                56.3

                150

                62.1

                11

                61.1

                160

                p49

                149529

                <

                150914

                L

                461

                166

                100

                167

                97.4

                9

                57.4

                142

                49.2

                151

                78.0

                12

                35.9

                161

                ie0

                150932

                <

                151636

                L

                234

                167

                99.6

                168

                95.7

                8

                42.7

                141

                30.8

                152

                64.5

                  

                162

                rr1

                151802

                <

                154087

                E

                761

                168

                99.5

                169

                93.3

                    

                153

                62.3

                  

                Note. aColumn 3 indicates ORF location and transcriptional direction on the HearMNPV genome. bColumn 4 indicates the presence of early (E) and/or late (L) promoters located upstream of the start codon of each ORF. E indicates a TATA sequence followed by a CAGT or CATT mRNA start site sequence 20–40 nucleotides downstream, within 180 bp upstream of the start codon. L indicates the presence of a (A/T/G) TAAG up to 180 bp upstream of the initiation codon.

                HearMNPV ORFs had an average length of 870 bp, with ORF85 (helicase) being the largest (3,627 bp) and ORF99 (ctl, conotoxin-like protein) being the smallest (150 bp). The 162 predicted ORFs encode 46,677 aa. The total coding sequence and intergenic regions were 139,026 and 15,170 bp, which represented 90.16% and 9.84% of the genome, respectively. The four hrs were distributed along the genome, with sizes ranging from 724 to 1,766 bp, and their total sequence was 4,749 bp, accounting for 3.08% of the genome. Thirty-eight ORFs overlapped with adjacent ORFs by between 1 and 244 bp, with a total of 1485 bp.

                Of the 162 ORFs identified in HearMNPV, 21 possessed a consensus early promoter motif (a TATA box followed by a CAGT or CATT motif 20 to 40 bp downstream, and up to 180 bp upstream, of the initiation codon). Seventy-one ORFs only contained a late promoter motif ((A/T/G) TAAG up to 180 bp upstream of the initiation codon), and nine had both early and late promoter motifs, which might allow transcription during both the early and late stages of infection. Sixty-one ORFs lacked any recognizable consensus early or late promoter motifs up to 180 bp upstream of the ATG. Eighty-six ORFs (46%) were oriented in a clockwise direction and 76 ORFs (54%) were in a counter clockwise direction, according to the transcription orientation of the polyhedron gene.

                Comparison of HearMNPV ORFs to other baculoviruses

                The overall gene arrangement and the homology between genes of the HearMNPV and other baculoviruses genomes were compared using Identity-GeneParity analysis [26]. The gene content and organization of HearMNPV were compared with a group I NPV (AcMNPV [32]), Group II NPVs (MacoNPV-B [33] MacoNPV-A [34], HearSNPV-G4 [7] and AgseNPV [35]), and GV (HearGV [11]. HearMNPV shares 117 ORFs with AcMNPV, 161 ORFs with MacoNPV-B, 159 ORFs with MacoNPV-A, 123 with HearSNPV-G4, 147 with AgseNPV, and 89 with HearGV. The average amino acid sequence identities between HearMNPV and AcMNPV, MacoNPV-B, MacoNPV-A, HearSNPV-G4, AgseNPV and HearGV were 44.7%, 98.5%, 90.2%, 41.0%, 58.5%, and 38.6%, respectively.

                Comparison of the gene order between HearMNPV and MacoNPV-B revealed a significantly gap between orf 52 to orf 53 in the HearMNPV genome. The gap corresponds to a region of MacoNPV-B comprising orf54, 55, 56, 57, 58, 59, and 60. In addition, the orf66 and orf17 of HearMNPV are homologous to the orf18 and orf117 of MacoNPV-B with 99, 41.2% aa identity, respectively (Table 1). However, the locations of these homologues are not conserved. Relative to each other HearMNPV (x-axis) and MacoNPV-B (y-axis) contain 1 and 8 unique genes, respectively. However, HearMNPV and MacoNPV-B maintain perfect co-linearity in gene content and arrangement (Figure 4A).
                http://static-content.springer.com/image/art%3A10.1186%2F1743-422X-9-168/MediaObjects/12985_2012_1945_Fig4_HTML.jpg
                Figure 4

                Identity-Gene Parity Plots of HearMNPV with MacoNPV-B (A), MacoNPV-A (B), HearSNPV-G4 (C), AcMNPV (D), AgseNPV (E), and HearGV (F). Amino acid identity (%) of individual homologous ORFs of HearMNPV compared to other baculoviruses are shown in various colors. ORFs unique to each virus are placed on the x-axis and y-axis, respectively (black diamonds).

                The gene arrangement of HearMNPV was also completely collinear with that of MacoNPV-A. The result of the Identity-GeneParity analysis showed that relative to each other HearMNPV (x-axis) and MacoNPV-A (y-axis) contain 2 and 10 unique genes, respectively. There was also high collinearity between HearMNPV and MacoNPV-A (Figure 4B).

                In terms of gene content, arrangement, and homology level, HearMNPV is significantly distant from HearSNPV-G4, although they infect the same host, H. armigera. Relative to each other HearMNPV (x-axis) and HearSNPV-G4 (y-axis) contain 38 and 18 unique genes, respectively, and these genes are distributed throughout the genomes (Figure 4C). The ‘left’ part of the HearMNPV genome (ORF5-69) displayed a high degree of gene scrambling in the gene parity plot analysis. The homologous ORFs from HearMNPV 70 to 160 are approximately collinear with the HearSNPV-G4 ORFs 8 to 96; however, the direction of the diagonal indicates these regions are inverted, relative to each other, except for HearMNPV ORF102-107 (corresponding to HearSNPV-G4 ORF62–67). (Figure 4C)

                Relative to each other HearMNPV (x-axis) and AgseNPV (y-axis) contain 15 and 11unique genes, respectively. The collinearity between HearMNPV and AgseNPV was higher than that between HearMNPV and HearSNPV-G4, and lower than that between HearMNPV and MacoNPV-B or MacoNPV-A. (Figure 4E)

                The collinearity between HearMNPV and AcMNPV from Group I was lower than those between HearMNPV and NPVs from group II (Figure 4D); the parity analysis of HearMNPV and HearGV ORFs displayed a much more dispersed pattern (Figure 4F).

                Phylogenetic analysis

                Based on 29 concatenated, conserved genes [36], a phylogenetic tree was estimated for 54 baculoviruses. The results reflected the current systematic assignment of the viruses (Figure 5), indicating that HearMNPV and MacoNPV-B are grouped together and are distinct from HearSNPV-G4 HearSNPV-C1 and HearSNPV-NNg1. In addition, the phylogenetic analysis of three highly conserved genes (lef-8, lef-9, and polh) indicated that the HearMNPV sequences were separated from the other eighteen HearMNPV isolates [14]. These results imply that HearMNPV is a new isolate that differs from HearSNPV.
                http://static-content.springer.com/image/art%3A10.1186%2F1743-422X-9-168/MediaObjects/12985_2012_1945_Fig5_HTML.jpg
                Figure 5

                Phylogenetic analysis of concatenated amino acid sequence alignments, showing bootstrap values >50% for NJ and MP trees at each node (NJ/MP). The location of HearMNPV is shown in bold. The GenBank accession numbers of each virus are listed after the names.

                Genomic Comparison between HearMNPV and MacoNPV-B: HearMNPV lacks a 5.4-kb fragment that contains five ORFs

                Compared with the MacoNPV-B genome, the HearMNPV genome does not have a 5.4-kb fragment that contains ORF54, 55, 56, 57, and 58 (Figure 6). The nucleotide identities between HearMNPV orf52 1–633 bp, 639–896 bp, and 853–1050 bp and MacoNPV-B orf 53, orf 59, orf 60 are 98%, 98%, and 95%, respectively. Amino acids 147–349 of the protein encoded by HearMNPV orf52 are 100% identical to those of the protein encoded by MacoNPV-B orf 53 and amino acids (aa) 1–65 of the protein encoded by HearMNPV orf52 are 86% identical to the amino acid sequence of MacoNPV-B orf 60 (Figure 6, indicated by the gray parts in the circles and arrows). However, there was no aa sequence identity between the proteins encoded by HearMNPV orf52 and MacoNPV-B orf 59 (Figure 6, indicated by the black parts in the circles and arrows). The MacoNPV-A genome also lacked the 5.4-kb fragment, suggesting that an insertion in the genome might have lead to the division of ORF59 in MacoNPV-A [33].
                http://static-content.springer.com/image/art%3A10.1186%2F1743-422X-9-168/MediaObjects/12985_2012_1945_Fig6_HTML.jpg
                Figure 6

                Comparison of the genome structure of HearMNPV and MacoNPV-B. The left and right arrows represent ORFs in HearMNPV and MacoNPV-B genomes, respectively. The numbers above the arrows represent the names of the ORFs in HearMNPV and MacoNPV-B genomes. The lines between the names of the ORFs represent homologies between the HearMNPV and MacoNPV-B genomes. The black region of arrows in the circle or box represent the nucleotide sequences homologies and the gray region of arrows in the circle or box represent the amino acid sequence homologies. The down arrow indicates the sites where the 5.4-kb fragment is inserted. The letter A indicates that the ORF of HearMNPV has no homolog in the corresponding position of MacoNPV-B. The letter B represents the ORF unique to HearMNPV. Double Vertical Lines represent ORFs that are not in the HearMNPV and MacoNPV-B genomes.

                According to the sequence analysis of 54 whole genomes of baculoviruses, the 5.4-kb fragment present in MacoNPV-B but not in HearMNPV shared homologous sequences with XecnGV [30] and HearGV [11], by reverse alignment (Table 2). However, this phenomenon was not observed in other genomes. Combined with the phylogenetic analysis (Figure 5), the results suggest that the 5.4-kb fragment was gained during evolution of MacoNPV-B and thus the common ancestor of HearMNPV ORF52 evolved to MacoNPV-B ORF53, ORF59, and ORF60 through gaining 5.4-kb fragment, together with subsequent nucleotide mutations, deletions, and insertions (Figure 6). For recombination to occur, the different viruses species have to be coinfecting the same host at the same time. A relatively recent recombination event between ancestors of MacoNPV-B and XecnGV resulted in the insertion of a 5.4-kb fragment from an ancestor of XecnGV into the genome of an ancestor of MacoNPV-B genome, suggesting that these lineages were capable of infecting the same host species at some point during their history [33]. HearMNPV and HearGV could infect the same host cotton bollworm, H. armigera, which provides the opportunity for the natural recombination between two viruses. However, HearMNPV did not gain the 5.4-kb fragment from HearGV by recombination.
                Table 2

                Comparison of ORFs aa identity from 5.4-kb fragment of MacoNPV-B, XecnGV and HearGV

                MacoNPV-B

                Homologoues (% aa identity)

                ORF54

                ORF55

                ORF56

                ORF57

                ORF58

                XecnGV

                ORF65(98)

                ORF64(98)

                ORF62(93)

                ORF61(98)

                ORF131(84) ORF60(60)

                HearGV

                ORF60(94)

                ORF59(94)

                ORF58(55)

                ORF57(94)

                ORF133(89) ORF54(50)

                HearMNPV ORF66

                The nucleotide sequence of ORF66 has high nucleotide sequence similarity to MacoNPV-B’s ORF17 and ORF18. Presumably, a mutation gave rise to the division of HearMNPV ORF66 into two open read frames in MacoNPV-B.

                HearMNPV ORF66, located between ORF65 (dutpase) and ORF67 (bro-b), is 1779 bp long and encodes a protein 592aa. The aa sequence identity is 99% between the first 301aa of HearMNPV ORF66’s (874–1779 bp) and MacoNPV-B ORF18 (301aa). However, the genome sequence of HearMNPV ORF66 and MacoNPV-B ORF18 are not collinear (Figure 4A, Figure 6).

                Nucleotides 676–968 of HearMNPV ORF66 are 95% identical to MacoNPV-B ORF17; however, the amino acids encoded by this nucleotide sequence did not share amino acid identity with the protein encoded by MacoNPV-B ORF17 because of frameshifts and other mutations of a few nucleotides. There is also no sequence similarity between the N-terminal region (1–675 bp) of HearMNPV ORF66 and MacoNPV-B, either at the nucleotide or amino acid level (shown in the boxes of Figure 6).

                The HearMNPV ORF66 protein is 92% identical to the five homologous hr1, hr2, hr3, hr4, and hr5, each of approximately 608aa in size, of Heliothis virescens ascovirus -3e (HvAV-3e) [37], and 85% identical to the proteins encoded by orf34 (564aa) and orf77 (606aa) of Spodoptera frugiperda ascovirus-1a (SfAV-1a) [38]. The comparison showed that these homologous ORFs have four conserved cysteine domains, suggestive of a zinc-binding domain, hypothesized to be a DNA binding domain. This putative domain is found at the C terminus of a large number of transposase proteins, indicated that this might be related to gene duplication in the genome.

                Interestingly, we have found an element in the right and left flanking DNA sequences of HearMNPV orf66 had two perfect inverted terminal repeats (ITRs) of 13 nucleotides. Moreover, the tetranucleotide5-TTAA-3, which is very common in transposition of the TTAA family, is duplicated upon this element [39, 40] (Figure 7). This indicated that this element could insert exclusively at this insertion site (TTAA). However, the ORF66 has no amino acid identity with piggyBac transposase [41]by blastp analysis. Sequence analysis showed that the right and left flanking DNA sequences of HvAV-3e hr1, hr2, hr3, hr4, and hr5 also have two perfect ITRs of 13 nucleotides. However, the left flanking DNA sequences of MacoNPVB orf18 lacked the sequence CCTCCTAAGACCC. These results indicated homologous of HearMNPV orf66 in MacoNPVB was split into MacoNPVB orf18 and orf17 during evolution.
                http://static-content.springer.com/image/art%3A10.1186%2F1743-422X-9-168/MediaObjects/12985_2012_1945_Fig7_HTML.jpg
                Figure 7

                Diagram of the region with two DNA sequences flanking a putative Transposase ORF (HearMNPV orf66 ) of 1 779 bp encoding a protein with 592 amino acids. The tetranucleotide TTAA duplicated is characteristic of a transposition event by a transposable element. ITR represent the inverted terminal repeats.

                Searching for homologs of HearMNPV ORF66 among the baculoviruses revealed that only HearMNPV ORF66 (592aa), MacoNPV-B ORF18 (301aa), HearGV ORF53 (572aa), ORF157 (572aa), ORF157 (576aa), and PsunGV ORF39 (571aa) are homologous ORFs. The phylogenetic analysis indicated that HearGV ORF53, ORF157, and PsunGV ORF39 belong to the same phylogenetic branch, while HearMNPV ORF66, MacoNPV-B ORF18, HvAV-3e hr1–hr5, and SfAV-1a ORF34 and 37 belong to the same phylogenetic clade (Figure 8). HearMNPV and HvAV-3e are both isolated from cotton bollworms, HearMNPV ORF66 and HvAV-3e hr1–hr5 share a flank structure, and have the highest amino acid identity among the homologous genes in baculovirus and ascoviridae to date (excluding unreleased relevant data). This data indicated that these genes might have been exchanged among species and genera.
                http://static-content.springer.com/image/art%3A10.1186%2F1743-422X-9-168/MediaObjects/12985_2012_1945_Fig8_HTML.jpg
                Figure 8

                Phylogenetic analysis of the HearMNPV ORF66 amino acid sequence. The phylogenetic tree shows bootstrap values >50% for NJ and MP trees at each node (NJ/MP). The location of HearMNPV ORF66 is shown in bold. The sequences used are from Mamestra configurata NPV-96B (ORF18), Helicoverpa armigera GV(HearGV (ORF53 and ORF157), Pseudaletia unipuncta GV(ORF39), Heliothis virescens ascovirus 3e (HvAV-3e hr1hr5), and Spodoptera frugiperda ascovirus 1a (SfAV-1a ORF34 and ORF77).

                The genomic differences between HearMNPV and MacoNPV-B are mainly located between hr1 and hr2, including the deletion of the 5.4 kb fragment in HearMNPV and the changes in ORF66, both of which were close to a bro gene (Figure 6).

                HearMNPV ORF17

                The locations of the HearMNPV ORF17 and its homologue in the MacoNPV-B genome are not conserved. HearMNPV ORF17 only has 41.2% aa identity to MacoNPV-B ORF117(e = 6e-46, with 98% query coverage), while HearMNPV ORF110 was collinear at an aa identity of 97.2% with MacoNPV-B ORF117, indicating that HearMNPV ORF17 has no significant collinearity with the homologous ORF of MacoNPV-B.

                HearMNPV unique ORF

                HearMNPV ORF139 is 264 bp long and encodes a protein of 87 aa. There is an early promoter CATT motif in the 180 bp region upstream of the start codon. Using both BLASTX and BLASTP searching, no homologous protein was found among baculoviruses.

                bro genes

                The occurrence of the baculovirus repeat ORF (bro) gene family is a striking feature in many baculovirus genomes [42]. bro genes are associated with regions of viral genome rearrangement [43]. BmNPV BRO proteins have nucleic acid binding activity that influences host DNA replication and transcription [44]. BRO proteins function as nucleocytoplasmic shuttling proteins that utilize the CRM1-mediated nuclear export pathway [45]. We identified six bro genes dispersed among the genome of HearMNPV and named them bro-a to bro-f, according to the order of their appearance on the linearized genome. There are eight and seven bro genes in MacoNPV-A and MacoNPV-B, respectively. The bro genes are classified into four groups, based on the similarity of the 41-amimo acid core domain sequences used for LdMNPV BRO protein classification [46]. HearMNPV bro-c, bro-d, and bro-e belong to group I bro genes, bro-a and bro-b belong to group II bro genes, bro-f belongs to group IV There is no bro gene corresponding to MacoNPV-B bro-b, which belongs to group III. The HearMNPV genome also lacks homologs of the MacoNPV-A bro-a (group I) and bro-c (groupIII) genes.

                The HearMNPV bro-a, -b, -c, -d, -e, - f genes showed aa identities of 83%, 77.5%, 98.3%, 89.6%, 97.4%, and98.8% to MacoNPV-B bro-a, -c, -d, -e, -f, -g, respectively. MacoNPV-B bro-b is located in the region of 5.4 kb fragment of MacoNPV-B, which is lack in the HearMNPV genome.

                The HearMNPV bro-a gene had an N-terminal region from aa 1 to aa 134 with aa identities of 63% and 95% to MacoNPV-B bro-a and MacoNPV-A bro-b, respectively. The C-terminal region, from aa 135 to aa 331, has aa identities of 98% and 93% to MacoNPv-B bro-a and MacoNPV-A bro-b, respectively. This suggested that bro-a C-terminal regions are the highly conserved portions in these three virus genomes.

                HearMNPV bro-f shows high homology to a hypothetical protein P20 [47] from Leucania separata NPV (LeseNPV) and MacoNPV-A bro-h, which both encode 179 aa proteins with amino acid identities of 95% and 98%, respectively. HearMNPV bro-f shows the highest homology to MacoNPV-B bro-g, with an amino acid identity of 98.8%. However, amino acids 1–17 of HearMNPV bro-f are not found in MacoNPV-B bro-g.

                When comparing the bro genes of HearMNPV with MacoNPV-B, the lowest aa identity is between HearMNPV bro-b and MacoNPV-B bro-c, at 77.5%. The HearMNPV ORF66 gene is adjacent to HearMNPV bro-b and has changed much comparing with ORF17 and ORF18, which are closest to MacoNPV-B bro-c.

                The differences between HearMNPV bro-c, d, and e and their homologs in MacoNPV-B represent minor nucleotide insertions, deletions, and substitutions.

                The bro genes of HearMNPV differed from those of MacoNPV-B in both sequence and number, which indicated that the bro gene region is one of the most important in genomic variation of baculoviruses. The differences between HearMNPV and MacoNPV-B (the 5.4 kb fragment and the location of ORF66) were found in the vicinity of a bro gene. These differences indicated that bro gene might play a role in gene exchange, and, consequently, viral virulence and host range.

                hrs

                Variable numbers of hr sequences, composed of direct repeats containing a “core” imperfect palindrome and dispersed unevenly among the genome in AT rich intergenic regions, have been identified in most baculovirus genomes [48]. The baculovirus hrs act as enhancers of RNA polymerase II-mediated transcription of baculovirus early promoters [49], as well as functioning as origins of DNA replication in transient replication assays [50, 51]. They are also sites of frequent recombinant and rearrangement in baculovirus genomes [52, 53]. Four hrs were identified in the HearMNPV genome, with the sizes of 1185 bp (hr1), 1766 bp (hr2), 1074 bp (hr3) and 724 bp (hr4), respectively. The hrs are distributed throughout the HearMNPV genome: between orf14 and orf15, orf63 and orf64, orf130 and orf131, and orf138 and orf139 for hr 1, 2, 3, and 4, respectively. Sequence analysis confirmed that the four hrs comprise two apparent domains with perfect or near-perfect 40 bp palindromes (designated type A) and 31 bp flanking repeats (designated type B) at the head/end of one or both sides of the palindromes (Figure 9A). Each hr repeat sequence comprises two apparent domains (type A and type B) that is similar to that described for MacoNPV-A and MacoNPV-B [33, 34]. However, the repeat unit numbers in each hr of HearMNPV was different from MacoNPV-A and MacoNPV-B.
                http://static-content.springer.com/image/art%3A10.1186%2F1743-422X-9-168/MediaObjects/12985_2012_1945_Fig9_HTML.jpg
                Figure 9

                Comparison of the hr regions between HearMNPV and MacoNPV-B. Panel A: a deduced consensus sequence of domains A and B from each hr region was used for this alignment. Conserved sequences are indicated with different shading: black indicates 100% conservation, gray >70% conservation, and no shading <70% conservation. Panel B: arrows represent the direction and positions of the repeat-A and repeat-B regions, black boxes represent type A repeats and blank boxes represent type B repeats.

                The four hrs of HearMNPV are located at similar positions in the genome as those of MacoNPV-B and MacoNPV-A. Sequence alignment between HearMNPV and MacoNPV-B hrs indicated that these four homologous regions had some insertions/deletions of different sizes, giving rise to identities of 92.0%, 92.3%, 86.6%, 81.9%, respectively. hr1 has three insertions, two of 52 bp and 43 bp that contained only a type A repeat, and one of 147 bp that contained type A and type B repeats. hr2 has two insertions (209 bp and 81 bp) that contained both type A and type B repeats. hr3 has the biggest deletion (489 bp) and another large deletion of 136 bp, which also contained both type A and type B repeats. hr4 has a small deletion of 69 bp that also contains both type A and type B repeats (Figure 9B). The HearMNPV hr4 (724 bp) is shorter than the MacoNPV-B hr4 (1178 bp) occurrence, probably caused by the presence of HearMNPV ORF139, which is adjacent to HearMNPV hr4. HearNPV NNg1 contains five hrs (hr1-hr5), similar to HearNPV C1, G4, and HzNPV. The arrangement of these hrs on the genome is almost the same in HearNPV C1, G4 and HzNPV, and it is possible that variability in the hr sequences affect not only progeny virus production, but also the insecticidal activity of the Helicoverpa spp. NPVs [9]. The homologous regions are also suggested to be responsible for the difference in virulence between two Mamestra configurata NPV-A variants, v90/4 and v90/2 [54], indicating that the difference in the organization of the homologous regions of HearMNPV and MacoNPV-B are possibly associated with mechanisms of recombination.

                Conclusion

                HearMNPV differs significantly from HearSNPV not only in biological properties and morphology, but also in gene content, arrangement, and homology level based on genome sequence comparison, which considered to be different viruses, and not variants of the same virus. Although the average amino acid sequence identity between HearMNPV and MacoNPV-B is 98.5%, but their effective host range are different. Moreover, a 5.4-kb segment of the MacoNPV-B genome which is the apparent result of recombination with an ancestor of XecnGV is absent in the HearMNPV genome, suggesting that the recombination event responsible for the occurrence of this 5.4 kb segment occurred after the divergence of MacoNPV-B and HearMNPV. The location and length of HearMNPV orf66 and MacoNPV-B orf18 are different in their respective genomes. Phylogenetic analysis indicated that these events may occur after MacoNPV-B and MacoNPV-A separated from their ancestor. These distinct differences between HearMNPV and MacoNPV-B may account for their different host range.

                Declarations

                Acknowledgements

                This work was supported by grants from the National Natural Sciences Foundation of China (31070139) and the “973” Project (2012CB114602).

                Authors’ Affiliations

                (1)
                Biotechnology Research Institute, Chinese Academy of Agricultural Sciences
                (2)
                School of Biology and Chemical Engineering, Jiangsu University of Science and Technology
                (3)
                State Key Laboratory of Integrated Management of Pest Insects and Rodents, Institute of Zoology, Chinese Academy of Sciences

                References

                1. Zanotto PM, Kessing BD, Maruniak JE: Phylogenetic interrelationships among baculoviruses: evolutionary rates and host associations. J Invertebr Pathol 1993, 62:147–164.PubMedView Article
                2. Jehle JA, Blissard GW, Bonning BC, Cory JS, Herniou EA, Rohrmann GF, Theilmann DA, Thiem SM, Vlak JM: On the classification and nomenclature of baculoviruses: a proposal for revision. Arch Virol 2006, 151:1257–1266.PubMedView Article
                3. Zalucki MP, Murray DAH, Gregg PC, Fitt GP, Twine PH, Jones C: Ecology of Helicoverpa-Armigera (Hubner) and Heliothis-Punctigera (Wallengren) in the Inland of Australia - Larval Sampling and Host-Plant Relationships During Winter and Spring. Aust J Zool 1994, 42:329–346.View Article
                4. Moscardi F: Assessment of the application of baculoviruses for control of Lepidoptera. Annu Rev Entomol 1999, 44:257–289.PubMedView Article
                5. Shieh TR: Industrial production of viral pesticides. Adv Virus Res 1989, 36:315–343.PubMedView Article
                6. Zhang G: Research, development and application of Heliothis viral pesticide in China. Resour Environ Yangtze Valley 1994, 3:39–44.
                7. Chen X, IJkel WF, Tarchini R, Sun X, Sandbrink H, Wang H, Peters S, Zuidema D, Lankhorst RK, Vlak JM, et al.: The sequence of the Helicoverpa armigera single nucleocapsid nucleopolyhedrovirus genome. J Gen Virol 2001, 82:241–257.PubMed
                8. Zhang CX, Ma XC, Guo ZJ: Comparison of the complete genome sequence between C1 and G4 isolates of the Helicoverpa armigera single nucleocapsid nucleopolyhedrovirus. Virology 2005, 333:190–199.PubMedView Article
                9. Ogembo JG, Caoili BL, Shikata M, Chaeychomsri S, Kobayashi M, Ikeda M: Comparative genomic sequence analysis of novel Helicoverpa armigera nucleopolyhedrovirus (NPV) isolated from Kenya and three other previously sequenced Helicoverpa spp NPVs. Virus Genes 2009, 39:261–272.PubMedView Article
                10. Chen X, Zhang WJ, Wong J, Chun G, Lu A, McCutchen BF, Presnail JK, Herrmann R, Dolan M, Tingey S, et al.: Comparative analysis of the complete genome sequences of Helicoverpa zea and Helicoverpa armigera single-nucleocapsid nucleopolyhedroviruses. J Gen Virol 2002, 83:673–684.PubMed
                11. Harrison RL, Popham HJ: Genomic sequence analysis of a granulovirus isolated from the Old World bollworm, Helicoverpa armigera . Virus Genes 2008, 36:565–581.PubMedView Article
                12. Pritchett DW, Scott HA, Young SY: Serological relationships of five nuclearpolyhedrosis viruses from lepidopterous species. J Invertebr Pathol 1979,33(2):183–188.View Article
                13. Gettig RR, McCarthy WJ: Genotypic variation among wild isolates of Heliothis spp nuclear polyhedrosis viruses from different geographical regions. Virology 1982,117(1):245–252.PubMedView Article
                14. Rowley DL, Popham HJ, Harrison RL: Genetic variation and virulence of nucleopolyhedroviruses isolated worldwide from the heliothine pests Helicoverpa armigera , Helicoverpa zea , and Heliothis virescens . J Invertebr Pathol 2011,107(2):112–126.PubMedView Article
                15. Chen Y, Lin X, Yi Y, Lu Y, Zhang Z: Construction and application of a baculovirus genomic library. Z Naturforsch C 2009, 64:574–580.PubMed
                16. Nie ZM, Zhang ZF, Wang D, He PA, Jiang CY, Song L, Chen F, Xu J, Yang L, Yu LL, et al.: Complete sequence and organization of Antheraea pernyi nucleopolyhedrovirus, a dr-rich baculovirus. BMC Genomics 2007, 8:248.PubMedView Article
                17. Wang HZ, Huang Y, Si YH, Fang MG, Cheng XW, Vlak JM, Hu ZH: A Novel Expression System of Helicoverpa armigera single-nucleocapsid nucleopolydrovirus. Virologica Sinica 2002, 17:319–325.
                18. Wang H, Deng F, Pijlman GP, Chen X, Sun X, Vlak JM, Hu Z: Cloning of biologically active genomes from a Helicoverpa armigera single-nucleocapsid nucleopolyhedrovirus isolate by using a bacterial artificial chromosome. Virus Res 2003, 97:57–63.PubMedView Article
                19. Wu D, Deng F, Sun X, Wang H, Yuan L, Vlak JM, Hu Z: Functional analysis of FP25K of Helicoverpa armigera single nucleocapsid nucleopolyhedrovirus. J Gen Virol 2005,86(9):243924–243944.View Article
                20. Zheng GL, Li CY, Zhou HX, Li SW, Li GX, Xue M: Establishment of two new cell lines from the embryonic tissue of Helicoverpa armigera (Lepidoptera:Noctuidae)and their responses to baculovirus infection. Acta Entom ologica Sinica 2010, 53:167–174.
                21. Mangé A, Prudhomme JC: Comparison of Bombyx mori and Helicoverpa armigera cytoplasmic actin genes provides clues to the evolution of actin genes in insects. Mol Biol Evol 1999, 16:165–172.PubMedView Article
                22. Wheeler DL, Church DM, Federhen S, Lash AE, Madden TL, Pontius JU, Schuler GD, Schriml LM, Sequeira E, Tatusova TA, et al.: Database resources of the National Center for Biotechnology. Nucleic Acids Res 2003, 31:28–33.PubMedView Article
                23. Kool M, Vlak JM: The structural and functional organization of the Autographa californica nuclear polyhedrosis virus genome. Arch Virol 1993, 130:1–16.PubMedView Article
                24. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ: Basic local alignment search tool. J Mol Biol 1990, 215:403–410.PubMed
                25. Lauzon HA, Jamieson PB, Krell PJ, Arif BM: Gene organization and sequencing of the Choristoneura fumiferana defective nucleopolyhedrovirus genome. J Gen Virol 2005, 86:945–961.PubMedView Article
                26. Hu ZH, Arif BM, Jin F, Martens JW, Chen XW, Sun JS, Zuidema D, Goldbach RW, Vlak JM: Distinct gene arrangement in the Buzura suppressaria single-nucleocapsid nucleopolyhedrovirus genome. J Gen Virol 1998, 79:2841–2851.PubMed
                27. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S: MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol 2011, 28:2731–2739.PubMedView Article
                28. Asser-Kaiser S, Fritsch E, Undorf-Spahn K, Kienzle J, Eberle KE, Gund NA, Reineke A, Zebitz CP, Heckel DG, Huber J, et al.: Rapid emergence of baculovirus resistance in codling moth due to dominant, sex-linked inheritance. Science 2007, 317:1916–1918.PubMedView Article
                29. Lu HS: Insects virus and virus disease of insect. Beijing: Science Press; 1982.
                30. Hayakawa T, Ko R, Okano K, Seong SI, Goto C, Maeda S: Sequence analysis of the Xestia c-nigrum granulovirus genome. Virology 1999, 262:277–297.PubMedView Article
                31. IJkel WF, van Strien EA, Heldens JG, Broer R, Zuidema D, Goldbach RW, Vlak JM: Sequence and organization of the Spodoptera exigua multicapsid nucleopolyhedrovirus genome. J Gen Virol 1999, 80:3289–3304.PubMed
                32. Ayres MD, Howard SC, Kuzio J, Lopez-Ferber M, Possee RD: The complete DNA sequence of Autographa californica nuclear polyhedrosis virus. Virology 1994, 202:586–605.PubMedView Article
                33. Li L, Donly C, Li Q, Willis LG, Keddie BA, Erlandson MA, Theilmann DA: Identification and genomic analysis of a second species of nucleopolyhedrovirus isolated from Mamestra configurata . Virology 2002, 297:226–244.PubMedView Article
                34. Li Q, Donly C, Li L, Willis LG, Theilmann DA, Erlandson M: Sequence and organization of the Mamestra configurata nucleopolyhedrovirus genome. Virology 2002, 294:106–121.PubMedView Article
                35. Jakubowska AK, Peters SA, Ziemnicka J, Vlak JM, van Oers MM: Genome sequence of an enhancin gene-rich nucleopolyhedrovirus (NPV) from Agrotis segetum : collinearity with Spodoptera exigua multiple NPV. J Gen Virol 2006, 87:537–551.PubMedView Article
                36. van Oers MM, Vlak JM: Baculovirus genomics. Curr Drug Targets 2007, 8:1051–1068.PubMedView Article
                37. Asgari S, Davis J, Wood D, Wilson P, McGrath A: Sequence and organization of the Heliothis virescens ascovirus genome. J Gen Virol 2007, 88:1120–1132.PubMedView Article
                38. Bideshi DK, Demattei MV, Rouleux-Bonnin F, Stasiak K, Tan Y, Bigot S, Bigot Y, Federici BA: Genomic sequence of Spodoptera frugiperda Ascovirus 1a, an enveloped, double-stranded DNA insect virus that manipulates apoptosis for viral reproduction. J Virol 2006, 80:11791–11805.PubMedView Article
                39. Cary LC, Goebel M, Corsaro BG, Wang HG, Rosen E, Fraser MJ: Transposon mutagenesis of baculoviruses: analysis of Trichoplusia ni transposon IFP2 insertions within the FP-locus of nuclear polyhedrosis viruses. Virology 1989, 172:156–169.PubMedView Article
                40. Wang J, Miller ED, Simmons GS, Miller TA, Tabashnik BE, Park Y: piggyBac-like elements in the pink bollworm, Pectinophora gossypiella . Insect Mol Biol 2010, 19:177–184.PubMedView Article
                41. Carpes MP, Nunes JF, Sampaio TL, Castro ME, Zanotto PM, Ribeiro BM: Molecular analysis of a mutant Anticarsia gemmatalis multiple nucleopolyhedrovirus (AgMNPV) shows an interruption of an inhibitor of apoptosis gene (iap-3) by a new class-II piggyBac-related insect transposon. Insect Mol Biol 2009,18(6):747–757.PubMedView Article
                42. Bideshi DK, Renault S, Stasiak K, Federici BA, Bigot Y: Phylogenetic analysis and possible function of bro-like genes, a multigene family widespread among large double-stranded DNA viruses of invertebrates and bacteria. J Gen Virol 2003, 84:2531–2544.PubMedView Article
                43. Willis LG, Seipp R, Stewart TM, Erlandson MA, Theilmann DA: Sequence analysis of the complete genome of Trichoplusia ni single nucleopolyhedrovirus and the identification of a baculoviral photolyase gene. Virology 2005, 338:209–226.PubMedView Article
                44. Zemskov EA, Kang W, Maeda S: Evidence for nucleic acid binding ability and nucleosome association of Bombyx mori nucleopolyhedrovirus BRO proteins. J Virol 2000, 74:6784–6789.PubMedView Article
                45. Kang W, Kurihara M, Matsumoto S: The BRO proteins of Bombyx mori nucleopolyhedrovirus are nucleocytoplasmic shuttling proteins that utilize the CRM1-mediated nuclear export pathway. Virology 2006, 350:184–191.PubMedView Article
                46. Kuzio J, Pearson MN, Harwood SH, Funk CJ, Evans JT, Slavicek JM, Rohrmann GF: Sequence and analysis of the genome of a baculovirus pathogenic for Lymantria dispar . Virology 1999, 253:17–34.PubMedView Article
                47. Xiao H, Qi Y: Genome sequence of Leucania seperata nucleopolyhedrovirus. Virus Genes 2007, 35:845–856.PubMedView Article
                48. Kool M, Ahrens CH, Vlak JM, Rohrmann GF: Replication of baculovirus DNA. J Gen Virol 1995, 76:2103–2118.PubMedView Article
                49. Theilmann DA, Stewart S: Tandemly repeated sequence at the 3' end of the IE-2 gene of the baculovirus Orgyia pseudotsugata multicapsid nuclear polyhedrosis virus is an enhancer element. Virology 1992, 187:97–106.PubMedView Article
                50. Ahrens CH, Pearson MN, Rohrmann GF: Identification and characterization of a second putative origin of DNA replication in a baculovirus of Orgyia pseudotsugata . Virology 1995, 207:572–576.PubMedView Article
                51. Pearson MN, Rohrmann GF: Lymantria dispar nuclear polyhedrosis virus homologous regions: characterization of their ability to function as replication origins. J Virol 1995, 69:213–221.PubMed
                52. Hayakawa T, Rohrmann GF, Hashimoto Y: Patterns of genome organization and content in lepidopteran baculoviruses. Virology 2000, 278:1–12.PubMedView Article
                53. Harrison RL, Bonning BC: Comparative analysis of the genomes of Rachiplusia ou and Autographa californica multiple nucleopolyhedroviruses. J Gen Virol 2003, 84:1827–1842.PubMedView Article
                54. Li L, Li Q, Willis LG, Erlandson M, Theilmann DA, Donly C: Complete comparative genomic analysis of two field isolates of Mamestra configurata nucleopolyhedrovirus-A. J Gen Virol 2005, 86:91–105.PubMedView Article

                Copyright

                © Tang et al.; licensee BioMed Central Ltd. 2012

                This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://​creativecommons.​org/​licenses/​by/​2.​0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

                Advertisement