Sequencing of bovine herpesvirus 4 v.test strain reveals important genome features

  • Leonor Palmeira1,

    Affiliated with

    • Bénédicte Machiels1,

      Affiliated with

      • Céline Lété1,

        Affiliated with

        • Alain Vanderplasschen1 and

          Affiliated with

          • Laurent Gillet1Email author

            Affiliated with

            Virology Journal20118:406

            DOI: 10.1186/1743-422X-8-406

            Received: 17 June 2011

            Accepted: 16 August 2011

            Published: 16 August 2011

            Abstract

            Background

            Bovine herpesvirus 4 (BoHV-4) is a useful model for the human pathogenic gammaherpesviruses Epstein-Barr virus and Kaposi's Sarcoma-associated Herpesvirus. Although genome manipulations of this virus have been greatly facilitated by the cloning of the BoHV-4 V.test strain as a Bacterial Artificial Chromosome (BAC), the lack of a complete genome sequence for this strain limits its experimental use.

            Methods

            In this study, we have determined the complete sequence of BoHV-4 V.test strain by a pyrosequencing approach.

            Results

            The long unique coding region (LUR) consists of 108,241 bp encoding at least 79 open reading frames and is flanked by several polyrepetitive DNA units (prDNA). As previously suggested, we showed that the prDNA unit located at the left prDNA-LUR junction (prDNA-G) differs from the other prDNA units (prDNA-inner). Namely, the prDNA-G unit lacks the conserved pac-2 cleavage and packaging signal in its right terminal region. Based on the mechanisms of cleavage and packaging of herpesvirus genomes, this feature implies that only genomes bearing left and right end prDNA units are encapsulated into virions.

            Conclusions

            In this study, we have determined the complete genome sequence of the BAC-cloned BoHV-4 V.test strain and identified genome organization features that could be important in other herpesviruses.

            Background

            Gammaherpesviruses are archetypal persistent viruses which are ubiquitous in both human and animal populations. The human gammaherpesviruses, Epstein-Barr virus (EBV) and Kaposi's Sarcoma-associated Herpesvirus (KSHV), infect respectively some 90% [1] and 30% [2] of human populations and cause several cancers [2, 3]. Although much effort has been invested on these viruses, studies of EBV or KSHV are difficult to perform directly because these viruses show limited lytic growth in vitro and have no well-established in vivo infection model. Related animal gammaherpesviruses are therefore an important source of information.

            Bovine herpesvirus 4 (BoHV-4) belongs to the Gammaherpesvirinae subfamily, and to the Rhadinovirus genus [4]. Similarly to its human counterparts, BoHV-4 was found to be widespread in all bovine populations and to persist in the vast majority of individuals as a lifelong, asymptomatic infection [5]. However, in some circumstances, BoHV-4 has been associated with various clinical symptoms such as skin lesions, respiratory diseases, metritis, malignant catarrhal fever or tumors [5].

            The virus was first isolated in Europe by Bartha et al. from calves with respiratory diseases [6] and later in North America by Mohanty et al. [7]. Besides cattle, BoHV-4 has also been detected in a variety of ruminants. In particular, BoHV-4 seems to be highly prevalent among wild African buffalo (Syncerus caffer) which could be considered as the natural reservoir of the virus [810]. Overall, more than 40 BoHV-4 strains have been isolated across the world. These strains can be classified in three groups: the European strains (or Movar 33/63-like strains), the American strains (or DN 599-like strains) and the African buffalo strains [9].

            It is estimated that the taurine and buffalo strains diverged around 730,000 years ago [9] and that the European and North American clades diverged around 260,000 years ago [9]. The genome of the BoHV-4 66-p-347 North American strain has entirely been sequenced [11]. However, the BAC-cloned reference strain V.test [12, 13] belongs to the European clade [9, 14]. Previous studies suggested that the BoHV-4 V-test strain contains regions of high dissimilarity compared to the BoHV-4 66-p-347 strain. Indeed, the nucleotide identity between the two strains has been previously measured to be as low as 88% on the BORFB2 region [11]. However, the lack of a complete genomic sequence for the V.test strain prevents from drawing a general view concerning this divergence level. Therefore, the low quality of the genomic information hampers the use of the BAC-cloned BoHV-4 V.test strain as a good model for studying gammaherpesvirus biology. In this study, we have determined the genomic sequence of the BoHV-4 V.test strain and analyzed its overall differences with the available sequence of the BoHV-4 66-p-347 strain [11, 15]. The results obtained highlighted important differences between BoHV-4 66-p-347 and V.test strains. Moreover complete sequencing of the BoHV-4 V.test strain also revealed genome features potentially important in other herpesviruses.

            Methods

            BAC sequencing

            BAC DNA was purified using Qiagen large-construct kit as described by the manufacturer. The complete BAC cloned viral genome of BoHV-4 V.test strain was determined by pyrosequencing using the 454 GS FLX Titanium (Roche) high-throughput sequencer and resulted in 48,967 reads of an average read length of 265 nucleotides and a total of 12,997,275 bases. A targeted ABI-Sanger sequencing of fragments of the prDNA region was also conducted using the primers listed in Table 1. The raw 454 data has been deposited in the NCBI Sequence Read Archive (SRA) database with accession number SRA037246.
            Table 1

            Primers used in this study

            name

            Sequence

            Coordinates according to Genbank

            Bo1 Fwd

            5'- ATGGAGGGTGATGGATTCATG-3'

            460-440a

            Bo1 Rev

            5'- TTAAGGCCTCATTCCAGGAAG-3'

            272-292a

            Bo5 Fwd

            5'- GCTACAGAAAATGGCCAGTAAAG-3'

            20366-20342a

            Bo5 Rev

            5'- TCATGTCCTGAGTGGGTCTATG-3'

            19170-19191a

            Bo6 Fwd

            5'- ATGGTCATCCTAAATGCTCAAG -3'

            20297-20318a

            Bo6 Rev

            5'- TCACCTAGTGTTGCAACCCC -3'

            20497-20478a

            Bo7 Fwd

            5'- ATGGAGACAATTTCCATAAACTG -3'

            20994-20972a

            Bo7 Rev

            5'- CTAGCTGGGGTAGAGTGATC -3'

            20671-20690a

            ORF67.5 Fwd

            5'- ATGGCTGATGGTGATGTTTTAG -3'

            93144-93123a

            ORF67.5 Rev

            5'- TCAATGTTTGTCCAGAGCACT -3'

            92881-92901a

            Bo12 Fwd

            5'- ATGGGGGCGCTATTTGGGC -3'

            97442-97460a

            Bo12 Rev

            5'- TCAACTGATGAAACCCACCC -3'

            97525-97506a

            Bo13 Fwd

            5'- ATGCGTCTCGATGGCAAGC -3'

            98838-98856a

            Bo13 Rev

            5'- CTATGGTTGTTTTTTAAAGAAAATC -3'

            98981-98957a

            ORF75 Fwd

            5'- ATGTATCCCAGATACAGTAACA -3'

            103606-103585a

            ORF75 Rev

            5'- TTACATTTTATTTTTCAGACACCA -3'

            100274-100297a

            prDNA Fwd 1

            5'- GGAGCCCAAAACCAAAAGAG -3'

            870-889b

            prDNA Rev 1

            5'- CTCTTTTGGTTTTGGGCTCC -3'

            889-870b

            prDNA Fwd 2

            5'- CGTAGGCCTCACATTCAGC -3'

            908-926b

            prDNA Rev 2

            5'- GCTGAATGTGAGGCCTACG -3'

            926-908b

            prDNA Fwd 3

            5'- CGAGAGATGGTTCTTGCACA -3'

            940-959b

            prDNA Rev 3

            5'- TGTGCAAGAACCATCTCTCG -3'

            959-940b

            BAC Rev

            5'- TTGCCAATCCCAAAAAGAAG -3'

            9859-9878c

            a according to Genbank JN133502 sequence (BoHV-4 V.test strain long unique region)

            b according to Genbank JN133504 sequence (BoHV-4 V.test strain prDNA inner region)

            c according to Genbank AY665170.1 sequence (pBeloBAC modified)

            BoHV-4 genome LUR assembly

            The reads were de novo assembled with gsAssembler (Roche), where the E. coli genome was used as a contaminant to filter out cellular reads [16]. The filtering removed 1,167 contaminant cellular reads. The de novo assembly yielded 11 contigs which were subsequently BLASTed against 66-p-347's long unique region (LUR) and polyrepetitive DNA (prDNA) -accession numbers NC_002665 and AF092919- to define their relative positions [17]. Contigs were assembled into a large scaffold using two previously published V.test sequences (accession numbers Z46380 and Z46385 [18]) overlapping contig borders. A careful comparison of the bordering contigs with the previously sequenced fragments showed a high percent identity (> 99.99%). After verification of the quality of the assembly, the BAC sequence was removed and the genome sequence was annotated as detailed hereunder.

            BoHV-4 genome prDNA assembly

            The prDNA was determined by a hybrid 454/ABI-Sanger strategy where 17 ABI-Sanger fragments of prDNA were de novo assembled with the 454 reads. Briefly, in order to correctly assemble the prDNA and to disentangle different prDNA units, this second de novo assembly was optimized for highly repetitive segments using MIRA [19]. 454 reads and quality information were extracted from the raw .sff file with 'sff_extract'. The base-calling and quality-calling for Sanger sequences were inferred from the .ab1 raw chromatogram files using 'phred' [20, 21] and the sequences were quality-trimmed using 'lucy' [22]. MIRA assembler (v 3.2.0) was used to build an assembly of the V.test genome with the following flags and options: "-job = denovo, genome, accurate, sanger, 454 -highlyrepetitive -AS:klrs = no 454_SETTINGS -AS:urdcm = 1.1:ardml = 100''. This assembly yielded a very large contig containing a complete prDNA unit, and a second contig containing an incomplete unit bearing the prDNA/prDNA junction. The complete prDNA unit was extracted from the first contig and identified as being the last prDNA unit before the LUR junction and noted prDNA-G following Bublot et al. [14]. By analysing the contig bearing the prDNA/prDNA junction in GAP4 [23], we determined a 518 bp fragment of the prDNA-inner unit (as named by Bublot et al. [14]) bordered on the left by lower read qualities and coverage, and on the right by the beginning of a new prDNA unit. This end was joined to the beginning (2,089 bp) of the prDNA-G unit in order to obtain a complete prDNA-inner unit (2,607 bp). We verified that this complete unit was compatible with previously published information [14].

            BoHV-4 genome annotation

            All Open Reading Frames (ORFs) from all 6 frames were retrieved from the complete genomic sequence and matched against the Conserved Domain Database [24] using the position-specific scoring matrices (PSSM) based Reverse PSI-BLAST [25]. For all ORFs sharing the same STOP and containing a PSSM match, the smallest ORF containing the largest PSSM match was retained. 59 ORFs were thus considered evolutionarily conserved and were annotated with the corresponding matching conserved domains. Out of the 79 CDS from the previously published 66-p-347 strain, all 59 ORFs matched previously annotated 66-p-347 ORFs. The 20 remaining CDS were added by similarity to this strain and were annotated as such. Repeat segments and special features were annotated according to 66-p-347 if they were present in V.test. The complete genome sequence containing the LUR, prDNA-G and prDNA-inner were annotated and submitted to GenBank with respective accession numbers: JN133502, JN133503 and JN133504.

            Comparative genomics analysis of 66-p-347 and V.test

            The LUR and prDNA sequences of the 66-p-347 strain were joined into a complete genome (accession numbers NC_002665 and AF092919) and aligned against the joined LUR and prDNA-inner V.test sequences with ClustalW 2.0.10 [26]. Percent divergence, percent insertions and deletions, and percent G+C content were computed (i) along the alignment on a 100 bp sliding window of step 3 bp and (ii) on all individually aligned proteins. Analyses and figures were conducted using R [27] and the seqinr [28] package in combination with ad hoc programs written in Python and using the Biopython libraries [29, 30].

            RT-PCR analysis

            These experiments were performed as described elsewhere [31]. Briefly, subconfluent monolayers of MDBK cells were infected with BoHV4 V.test strain at a m.o.i. of 1 PFU/cell. 18 hours after infection, cytoplasmic RNA was extracted, purified and treated for RT-PCR. The cDNA products were amplified by PCR using specific primers listed in Table 1.

            Results and discussion

            BAC sequencing and genome assembly

            Pyrosequencing of herpesviral genomes is often limited by the high concentration of contaminating cellular DNA [32]. We therefore prepared the BoHV-4 V.test strain DNA from BAC maintained genomes and sequenced it using a high-throughput pyrosequencing approach [16]. This yielded 48,967 reads among which 47,800 were BoHV-4 specific (> 97% of the reads). After assembly, the mean genome coverage was of the order of 96×. In comparison to the whole genome sequencing of another herpesvirus based on DNA isolated from virus particles, which exhibited a 13× average base pair coverage [32], our strategy showed a more than 7-fold increase. This is probably mainly due to the high proportion of viral to cellular reads present in our dataset. Indeed, only 1,167 Escherichia coli contaminant reads had to be discarded from the data, indicating less than 2.38% of contaminated reads, compared to the previously reported 62.72% contaminating cellular reads in [32]. Our sequencing strategy based on a BAC cloning approach, thus revealed itself very powerful in terms of contamination and subsequent coverage.

            V.test genome analysis and comparison to other BoHV-4 strains

            The BoHV-4 genome has a B-type structure consisting of a long unique region (LUR) flanked by several polyrepetitive DNA units (prDNA). We assembled the complete LUR of the V.test strain BoHV-4 genome into a 108,241 bp sequence. The average G+C content is of 41.21%. This value as well as the G+C% variation observed on Figure 1 is in agreement with previously reported results on the 66-p-347 strain, namely on the high G+C content of R2a region [11]. The observed-to-expected CpG ratio is of 0.225 on the LUR and is compatible with the value measured on Bos taurus (0.234) [33] suggesting (i) a high degree of methylation of CpG nucleotides and (ii) similar methylation mechanisms acting on the viral and cellular genome.
            http://static-content.springer.com/image/art%3A10.1186%2F1743-422X-8-406/MediaObjects/12985_2011_1526_Fig1_HTML.jpg
            Figure 1

            Map of the BoHV-4 V.test strain genome and divergence with the 66-p-347 strain sequence. The LUR of both strains have been aligned. Genome features are represented in the upper part as grey and red oriented arrows. Red arrows represent genes with an in-frame STOP codon, an early Methionine or a high divergence level in the V.test strain compared to 66-p-347. Dark (resp. light) grey arrows represent genes with (resp. without) an evolutionarily conserved domain (see Methods). The exons of spliced genes are indicated under the given gene as thin light-blue lines. Percent divergence is shown as a black-filled curve, percent insertions and deletions are shown as a blue-filled curve. Percent G+C content is shown as a thin green curve, with the mean G+C content drawn as a thin horizontal green line. These percentages are measured in a 100 bp window sliding 3 bp. Repeat regions (R1, R2a, R2b) are depicted as hatched areas. The oriLyt region is mapped as a light-grey area within R2b and the conserved quasi-palindromic motif in the oriLyt region is indicated by a small vertical arrow.

            As expected, the nucleotide identity between our assembled genome and previously published V.test strain sequence data was of 99.55% in average, falling into the ranges of comparison between 454 and Sanger sequencing [34].

            Compared to the 66-p-347 strain, the V.test strain had previously shown divergence up to 12% on the region surrounding BORFB2 (ORF 16, v-Bcl-2) [11]. However, the lack of a complete genomic sequence for the V.test strain prevented from drawing a general conclusion concerning this divergence level. Compared to 66-p-347 strain, the overall V.test nucleotide identity is high (99.1%), but shows a large variability at the genome level (Figure 1). As expected, the repetitive regions contained in the LUR (R1, R2a and R2b) exhibit a high nucleotide divergence, up to more than 40%, as well as large gaps (Figure 1). This indicates that the very high divergence levels seem confined to specific repetitive genomic regions. However, some rather high divergence levels were also identified in other regions (Figure 1) and namely in ORF-containing regions such as ORF 10, Bo5, ORF 57, and ORF 68 region. We also note a large deletion and a high divergence at the beginning of the LUR compared to the 66-p-347 strain. Overall, these differences in protein-coding region as well as in repetitive regions that bear predicted microRNA coding sequences [35] will require specific experiments to identify possible links with observed phenotypic differences between strains.

            Conserved protein-coding genes

            In order to develop an ab initio approach of gene annotation, we extracted all possible ORFs in all 6 frames from the complete genomic sequence of the BoHV-4 V.test strain. On each of these ORFs, we ran a Reverse PSI-BLAST [25] against all protein domains from the Conserved Domain Database [24]. ORFs containing an evolutionarily conserved domain were defined as the smallest ORF containing the longest CDD match (see Methods). This approach revealed 59 ORFs containing a conserved CDD domain (Table 2). All 59 detected ORFs corresponded to ORFs previously annotated in the 66-p-347 strain (on a total of 79 ORFs listed in Table 3), indicating that 75% of BoHV-4 ORFs contain conserved domains. Most of these ORFs (37/59) contain domains that are either conserved at different levels in the Herpesvirales (either gammaherpesvirinae, herpesviridae or herpesvirales), or at a much larger scale that include Eukaryota, Bacteria and Archaea (22/59) (Table 2). This second set of genes might bear good candidates for genes having been the stage of lateral gene transfer events as observed for several herpesvirus genes [36] such as the BoHV-4 Bo17 gene that encodes a homologue of the cellular core 2 beta -1,6-N-acetylglucosaminyl-transferase M [37]. These results will deserve further studies to identify the evolutionary history responsible for these observations.
            Table 2

            Potential BoHV-4 V.test ORFs presenting conserved functional domains

            BoHV-4 ORF

            Domain accession number

            Functional annotation

            Species distributiona

            ORF 3

            COG0046, TIGR01735, TIGR01736, TIGR01739, PF02769

            Phosphoribosylformylglycinamidine (FGAM) synthase; AIR synthase related protein

            Eukaryota; Bacteria; Archaea; Viruses

            ORF 6

            PF00747

            ssDNA binding protein

            Herpesviridae

            ORF 7

            PF01366

            Protein transporter activity

            Herpesviridae

            ORF 8

            PF00606

            Surface glycoprotein

            Herpesviridae

            ORF 9

            COG0417, TIGR00592, PF00136, PF03104, SM00486

            DNA polymerase type-B family

            Eukaryota; Bacteria; Archaea; Viruses

            ORF 10

            PF04797

            dUTPase

            Herpesviridae

            Bo4

            COG5183, SM00744

            Protein involved in mRNA turnover and stability; zinc-finger RING-variant domain

            Eukaryota; Bacteria

            ORF 16

            SM00337

            BCL (B-Cell lymphoma); contains BH1, BH2 regions

            Eukaryota; Bacteria; Viruses

            ORF 17

            PF00716

            Serine-type endopeptidase activity

            Herpesviridae

            ORF 18

            PF03049

            UL79 family

            Herpesviridae

            ORF 19

            PF01499

            Virus penetration and capsid assembly

            Herpesviridae

            ORF 20

            PF01646

            UL24 family

            Herpesviridae

            ORF 21

            PF00693, PF01712, PF08465

            ATP binding; thymidine kinase activity; phosphotransferase activity

            Eukaryota; Bacteria; Viruses

            ORF 22

            PF02489

            Virion associated envelope glycoprotein

            Herpesviridae

            ORF 23

            PF04682

            BTRF1 protein conserved region

            Herpesviridae

            ORF 24

            PF03043

            UL87 family

            Herpesviridae

            ORF 25

            PF03122

            Structural molecule activity

            Herpesvirales

            ORF 26

            PF01802

            Structural molecule activity

            Herpesvirales

            ORF 29

            PF02499, PF02500

            Probable role in DNA packaging

            Herpesvirales

            ORF 30

            PF05338

            Unknown function (DUF717)

            Gammaherpesvirinae

            ORF 31

            TIGR01234, PF03048

            UL92 family; L-ribulokinase

            Herpesvirales; Embryophyta

            ORF 32

            PF04559

            DNA cleavage and packaging

            Herpesviridae

            ORF 33

            PF03044

            Possible role in capsid maturation

            Herpesviridae

            ORF 34

            PF03038

            UL95 family

            Herpesviridae

            ORF 35

            PF05852

            Unknown function (DUF848)

            Gammaherpesvirinae

            ORF 36

            COG0515, PF00069, SM00220

            ATP binding; protein kinase activity; Serine/threonine protein kinase

            Eukaryota; Bacteria; Archaea

            ORF 37

            PF01771, PF09588

            Exonuclease activity; DNA binding

            Eukaryota; Bacteria; Viruses

            ORF 38

            PF10813

            Unknown function (DUF2733)

            Herpesviridae

            ORF 39

            PF01528

            Integral membrane protein

            Herpesviridae

            ORF 40

            PF03324

            Helicase-primase complex associated protein

            Herpesviridae

            ORF 41

            PF05774

            Helicase-primase complex components

            Gammaherpesvirinae

            ORF 42

            PF01677

            UL7-like protein

            Herpesviridae

            ORF 43

            PF01763

            Possible role in cleavage and packaging

            Herpesviridae

            ORF 44

            COG0507, PF02689

            Helicase; ATP-dependent exoDNAse (exonuclease V)

            Eukaryota; Bacteria; Viruses

            ORF 46

            COG0692, TIGR00628, TIGR03443, PF03167

            Uracil DNA glycosylase

            Eukaryota; Bacteria; Archaea; Viruses

            ORF 47

            PF11108

            Glycoprotein L

            Herpesviridae

            ORF 48

            PF05734

            Unknown function (DUF832)

            Herpesviridae

            ORF 50

            PF03326, PF04793

            Early-intermediate transcription factors

            Gammaherpesvirinae

            Bo10

            PF05459, PF05812

            Transcriptional regulator proteins

            Herpesviridae

            ORF 53

            PF03554

            Highly polymorphic glycoprotein

            Herpesviridae

            ORF 54

            COG0756, TIGR00576, PF00692

            dUTPase

            Eukaryota; Bacteria; Archaea; Viruses

            ORF 55

            PF04533

            U44 protein

            Herpesviridae

            ORF 56

            PF03121

            UL52/UL70 DNA primase

            Eukaryota; dsDNA Viruses

            ORF 57

            PF04633

            BMRF2 protein

            Gammaherpesvirinae

            ORF 59

            PF04929

            DNA replication accessory factor

            Gammaherpesvirinae

            ORF 60

            COG0208, PF00268

            Ribonucleotide reductase

            Eukaryota; Bacteria; Archaea; Viruses

            ORF 61

            COG0209, TIGR02504, TIGR02506, TIGR02510, PF00317, PF02867

            Ribonucleotide reductase

            Eukaryota; Bacteria; Archaea; Viruses

            ORF 62

            PF03327

            Capsid shell protein VP19C

            Herpesviridae

            ORF 63

            PF04523

            Tegument protein U30

            Herpesviridae

            ORF 64

            PF04843

            Tegument protein, N-terminal conserved region

            Herpesviridae

            ORF 65

            PF06112

            Capsid protein

            Gammaherpesvirinae

            ORF 66

            PF03117

            UL49 family

            Herpesviridae

            ORF 67

            PF04541

            Virion protein U34

            Herpesviridae

            ORF 67.5

            PF03581

            UL33-like protein

            Herpesviridae

            ORF 68

            PF01673

            Putative major envelope glycoprotein

            Herpesviridae

            ORF 69

            PF02718

            UL31-like protein

            Herpesviridae

            ORF 71

            PF01335, SM00031

            Death effector domain

            Eukaryota; Viruses

            ORF 75

            COG0046, COG0047, TIGR01735, TIGR01736, TIGR01739, TIGR01857, PF02769

            Phosphoribosylformylglycinamidine (FGAM) synthase; AIR synthase related protein

            Eukaryota; Bacteria; Archaea; Viruses

            Bo17

            PF02485

            Core-2/I-Branching enzyme

            Eukaryota; Bacteria; Viruses

            Conserved functional domains were determined for each BoHV-4 V.test ORF using METHOD and the domains accession numbers, functional annotation and the species distribution were listed. When several domains were conserved, the annotations were either merged when possible or juxtaposed. Domains present in herpesviridae conserved gene families are highlighted in bold (from Fu, 2008). (PFxxx: Pfam Accession Number; SMxxx: SMART Accession Number; COGxxx: COG Accession Number; TIGRxxx: TIGRFam Accession Number).

            a Major taxonomic groups.

            Table 3

            Potential BoHV-4 V.test ORFs and homologues to HHV-8 and HHV-1

            BoHV-4 ORF

            Strand

            Starta

            Stopa

            HHV-8 homologueb

            HHV-1 homologuec

            Annotation and comments

            Bo1

            -

            272

            460

            --

            --

            Early in-frame STOP codon

            ORF 3

            +

            441

            4307

            --

            --

            BORFA1; v-FGAM-synthase

            Bo2

            +

            4435

            4638

            --

            --

             

            Bo3

            +

            5072

            5299

            --

            --

             

            ORF 6

            +

            5703

            9107

            ORF 6

            UL 29

            single-stranded DNA-binding protein MDBP

            ORF 7

            +

            9112

            11190

            ORF 7

            UL 28

            transport protein

            ORF 8

            +

            11180

            13804

            ORF 8

            UL 27

            glycoprotein B

            ORF 9

            +

            13944

            16961

            ORF 9

            UL 30

            DNA polymerase

            ORF 10

            +

            17057

            18337

            ORF 10

            --

            BORFB1

            Bo4

            -

            18604

            19101

            --

            --

            short ORF of immediate early transcript 1

            Bo5

            -

            19170

            20355

            K5

            --

            long ORF of immediate early transcript 1

            Bo6

            +

            20297

            20590

            --

            --

            Early in-frame STOP codon

            Bo7

            -

            20670

            20994

            --

            --

            Disrupted frame

            Bo8

            +

            21318

            21521

            --

            --

            overlapping with late 1.7 kb RNA

            ORF 16

            +

            22967

            23647

            ORF 16

            --

            BORFB2; v-Bcl-2 protein

            ORF 17

            -

            23710

            25260

            ORF 17

            UL 26

            capsid protein

            ORF 18

            +

            25259

            26077

            ORF 18

            --

             

            ORF 19

            -

            26029

            27705

            ORF 19

            UL 25

            tegument protein

            ORF 20

            -

            27407

            28219

            ORF 20

            UL 24

             

            ORF 21

            +

            28203

            29540

            ORF 21

            UL 23

            thymidine kinase

            ORF 22

            +

            29551

            31674

            ORF 22

            UL 22

            glycoprotein H

            ORF 23

            -

            31671

            32873

            ORF 23

            --

             

            ORF 24

            -

            32851

            35109

            ORF 24

            --

             

            ORF 25

            +

            35099

            39220

            ORF 25

            UL 19

            major capsid protein

            ORF 26

            +

            39256

            40170

            ORF 26

            UL 18

            capsid protein

            ORF 27

            +

            40184

            40829

            ORF 27

            --

             

            Bo9

            +

            40831

            41130

            --

            --

             

            ORF 29

            -

            41154

            46328

            ORF 29

            UL 15

            cleavage/packaging protein

            ORF 30

            +

            42306

            42548

            ORF 30

            --

             

            ORF 31

            +

            42482

            43123

            ORF 31

            --

             

            ORF 32

            +

            43069

            44439

            ORF 32

            UL 17

            viral DNA cleavage/packaging protein

            ORF 33

            +

            44432

            45430

            ORF 33

            UL 16

             

            ORF 34

            +

            46327

            47313

            ORF 34

            --

             

            ORF 35

            +

            47285

            47758

            ORF 35

            --

             

            ORF 36

            +

            47787

            48950

            ORF 36

            UL 13

            kinase

            ORF 37

            +

            48958

            50427

            ORF 37

            UL 12

            alkaline exonuclease

            ORF 38

            +

            50379

            50585

            ORF 38

            --

             

            ORF 39

            -

            50652

            51761

            ORF 39

            UL 10

            glycoprotein M

            ORF 40

            +

            51877

            53247

            ORF 40

            UL 8

            helicase-primase complex component

            ORF 41

            +

            53360

            53881

            ORF 41

            --

            helicase-primase complex component

            ORF 42

            -

            53873

            54748

            ORF 42

            UL 7

             

            ORF 43

            -

            54525

            56375

            ORF 43

            UL 6

            capsid protein

            ORF 44

            +

            56323

            58701

            ORF 44

            UL 5

            helicase

            ORF 45

            -

            58805

            59530

            ORF 45

            --

             

            ORF 46

            -

            59530

            60291

            ORF 46

            UL 2

            uracil-DNA-glycosidase

            ORF 47

            -

            60309

            60731

            ORF 47

            --

            glycoprotein L

            ORF 48

            -

            60838

            62382

            ORF 48

            --

             

            ORF 50

            +

            62586

            65179

            ORF 50

            --

            immediate early transcript 2; R transactivator protein

            ORF 49

            -

            62600

            63499

            ORF 49

            --

             

            Bo10

            +

            65696

            66595

            --

            UL 54

            glycoprotein gp80

            ORF 52

            -

            66621

            67007

            ORF 52

            --

             

            ORF 53

            -

            67073

            67345

            ORF 53

            --

             

            ORF 54

            +

            67414

            68262

            ORF 54

            UL 50

            dUTPase

            ORF 55

            -

            68321

            68923

            ORF 55

            --

             

            ORF 56

            +

            68887

            71418

            ORF 56

            UL 52

            DNA replication protein

            ORF 57

            +

            71512

            72870

            ORF 57

            --

            possible post-transcriptional transactivator

            ORF 58

            -

            73294

            74346

            ORF 58

            --

             

            ORF 59

            -

            74360

            75535

            ORF 59

            --

            DNA replication protein

            ORF 60

            -

            75688

            76605

            ORF 60

            UL 40

            ribonucleotide reductase small subunit

            ORF 61

            -

            76639

            79020

            ORF 61

            UL 39

            ribonucleotide reductase large subunit

            ORF 62

            -

            79002

            80021

            ORF 62

            UL 38

            assembly/DNA maturation protein

            ORF 63

            +

            79978

            82797

            ORF 63

            --

            tegument protein

            ORF 64

            +

            82812

            90488

            ORF 64

            UL 36

            tegument protein

            ORF 65

            -

            90504

            90896

            ORF 65

            --

            capsid protein

            ORF 66

            -

            90893

            92167

            ORF 66

            --

             

            ORF 67

            -

            92107

            92877

            ORF 67

            UL 34

            tegument protein

            ORF 67.5

            -

            92881

            93144

            ORF 67.5

            UL 33

            Disrupted (late) methionine

            ORF 68

            +

            93155

            94504

            ORF 68

            UL 32

            probable glycoprotein

            ORF 69

            +

            94512

            95405

            ORF 69

            UL 31

             

            Bo11

            -

            96158

            96703

            --

            --

             

            Bo12

            +

            97442

            97684

            --

            --

            Early in-frame STOP codon

            ORF 71

            -

            98328

            98876

            K13/ORF 71

            --

            BORFE2; v-FLIP

            Bo13

            +

            98838

            98983

            --

            --

            Disrupted frame

            ORF 73

            -

            99022

            99783

            ORF 73

            --

            BORFE3, LANA homologous

            ORF 75

            -

            100274

            103606

            ORF 75

            --

            Disrupted (late) methionine; tegument protein/v-FGAM-synthetase

            Bo14

            -

            104273

            104785

            --

            --

             

            Bo15

            -

            105724

            106038

            --

            --

             

            Bo16

            +

            106225

            106494

            --

            --

             

            Bo17

            +

            106681

            108003

            --

            --

            viral beta-1,6-N-acetylglucosaminyltransferase

            a Positions of the respective ORFs of BoHV-4 on the LUR sequence. These are given from the first nucleotide of the start codon ATG to the last nucleotide of the stop codon.

            b Correspondance to HHV-8 genes is according to Zimmermann (2001).

            c Correspondance to HHV-1 genes was based on the presence of conserved domain with a BoHV-4 gene. Genes containing evolutionary conserved domains are highlighted in bold italic. The genes conserved in Herpesviridae are highlighted in bold (from Fu, 2008).

            Non-conserved protein-coding genes

            The remaining 20 annotated ORFs were determined by similarity to the 66-p-347 strain, and correspond for most of them to ORFs unique to BoHV-4 as described previously (Table 3) [11]. Some of these ORFs, however, contain odd characteristics that needed to be investigated (Figure 2, Additional file 1 Figures S1-9). Indeed Bo1, Bo6, Bo7, Bo12 and Bo13 genes of the BoHV-4 V.test strain present in-frame STOP codons. Bo5 presents rather high divergency levels and large insertions/deletions (> 5% of its coding sequence as shown in Figure 2) compared to the genomic sequence of the 66-p-347 strain. Moreover, ORFs 36, 67.5 and 75, which bear an evolutionary conserved domain, present late methionines compared to the 66-p-347 annotation. Indeed, in ORF 36 (see Additional file 1 Figures S5), the smallest ORF containing an evolutionary conserved domain is slightly shorter than the one annotated in 66-p-347 and there is no evidence that the previously annotated methionine is the correct one. However, comparison with homologous genes in other rhadinoviruses suggests that the start codon proposed in the 66-p-347 annotated sequence is the most likely. In ORF 67.5 (see Additional file 1 Figures S6), there is a point substitution in the 66-p-347 annotated ATG leading to the identification of a subsequent ATG as the V.test methionine. Finally, ORF 75 presents a small phase-disrupting indel in its 5' end (see Additional file 1 Figures S9), leading to the absence of the 66-p-347 annotated methionine in the V.test strain. All these annotated genes requested therefore an investigation of their transcription in mRNA products.
            http://static-content.springer.com/image/art%3A10.1186%2F1743-422X-8-406/MediaObjects/12985_2011_1526_Fig2_HTML.jpg
            Figure 2

            Proteins in V.test: divergence with the previously published 66-p-347 strain. Percentage divergence and percentages indels on the aligned amino-acid sequences are represented as, respectively, black and light-blue bars. The dotted black line represents a 5% threshold. Genes containing an evolutionarily conserved domain (see Methods) are represented on a light-grey background. Previously annotated genes presenting in the V.test strain an in-frame stop codon, a late Methionine or large divergence levels compared to the 66-p-347 strain are indicated in red.

            As these sequence properties could be specific to the BAC clone of the BoHV-4 V.test strain, we investigated the transcription of these genes on MDBK cells infected with the BoHV-4 V.test WT strain as described in the methods. The primers used are described in Table 1 and highlighted in Additional file 1. For all couple of primers, cDNA from BoHV-4-infected MDBK cells gave rise to the expected PCR products (Figure 3). The absence of contaminant viral DNA in the mRNA preparations was confirmed by a lack of PCR product without reverse transcriptase. The size of the Bo5 RT-PCR product was also consistent with its known mRNA splicing (868 bp rather than 1140 bp). Moreover, the sequences of these RT-PCR products were in agreement with the BoHV-4 V.test sequence derived from our BAC cloned genome (data not shown). Therefore, we can conclude that all these coding sequences are transcribed during BoHV-4 infection of MDBK cells. However, further investigation is needed to determine the presence of proteins and ensure their accurate annotation.
            http://static-content.springer.com/image/art%3A10.1186%2F1743-422X-8-406/MediaObjects/12985_2011_1526_Fig3_HTML.jpg
            Figure 3

            RT-PCR amplification of the coding regions of the genes Bo1, Bo5, Bo6, Bo7, ORF67.5, Bo12, Bo13 and ORF75 of the BoHV-4 V.test strain. Subconfluent monolayers of MDBK cells were infected with BoHV4 V.test strain at a m.o.i. of 1 PFU/cell. 18 hours after infection, cytoplasmic RNA was extracted, purified and treated for RT-PCR. The cDNA products were amplified by PCR using specific primers listed in Table 1.

            BoHV-4 V.test replication origin

            A large region containing the potential lytic replication origin (oriLyt) of the BoHV-4 66-p-347 strain was determined by Zimmermann et al [11]. Based on this information, we mapped this region on the V.test genome (Figure 1). This region contains Bo12, the R2b region and partially overlaps with Bo11. Compared to the 66-p-347 strain sequence, the corresponding region in the V.test genome is highly divergent (Figure 4). Although this region shows high divergence rates, we expected the replication origin to be conserved between the two BoHV-4 strains. Previous work on other herpesviruses has identified in oriLyt the presence of palindromic motifs essential for viral replication [3840]. When we compared the potential region containing oriLyt in the two strains, a single conserved palindromic region was observed (AATCCAGGCCCCTGATTGGTAGATTGCTGAAAGCCAATCAGGGGCCTGGATT, Figure 4). Interestingly, this region forms a perfect hairpin structure (Figure 4B) that resembles DNA structures formed at other herpesvirus origins [41, 42] and may therefore represent a common secondary structure used by all herpesvirus family members during the initiation of DNA replication. In the future, this structure will be tested as a candidate for an essential oriLyt replication motif.
            http://static-content.springer.com/image/art%3A10.1186%2F1743-422X-8-406/MediaObjects/12985_2011_1526_Fig4_HTML.jpg
            Figure 4

            Prediction of BoHV-4 V.test OriLyt. A. Alignment of the V.test strain (above) and 66-p-347 strain (below) regions predicted to contain the OriLyt in the 66-p-347 strain. The differences observed in the alignment are highlighted in light grey. The predicted potential OriLyt is highlighted in dark grey. B. The predicted secondary structures of the top (+) and bottom (-) strands of the predicted BoHV-4 OriLyt sequence were analyzed using the Vienna RNA website program RNAfold with DNA parameters. The predicted free energy (ΔG) of each structure is given, as well as the positional entropy of each nucleotide.

            BoHV-4 V.test polyrepetitive DNA

            In the BAC clone, previous restriction profiles had determined a hypermolar prDNA band indicating that the BAC contained several prDNA units [12]. Therefore, the major pitfall in the assembly of the BoHV-4 V.test strain was the determination of the prDNA sequence. Indeed, (i) the higher per base coverage on this region due to repetition of prDNA units, (ii) the high GC content, along with (iii) the presence of several long repeats within the prDNA and (iv) the variability observed between prDNA units [14] made it extremely difficult to resolve and assemble with pyrosequencing data alone. Interestingly, it has been shown for several rhadinoviruses that the left junction between the prDNA and the LUR is the site of genome rearrangements and that sequences of the prDNA are found within the first base pairs of the LUR. These properties make this region very difficult to sequence [4347].

            Therefore, we adopted a hybrid strategy consisting in adding some ABI-Sanger reads (with the primers described in Table 1) to guide the 454 assembly on the prDNA region (see Methods).

            Bublot, et al. [14] described the different prDNA unit variants present in BoHV-4 V.test, and namely the differences between prDNA units. Firstly, the prDNA units vary according to the number of repetitions of a ~200 bp Pst-I bordered fragment. Secondly, the last prDNA before the prDNA/LUR junction (prDNA-G) displays a different ending than the inner prDNA units [14]. Our method allowed us to disentangle the repeats and to assemble a contig containing a whole prDNA unit (2,440 bp) along with the left prDNA-LUR junction. This prDNA unit, corresponding to prDNA-G following Bublot et al. [14], was extracted from the contig and annotated. A second contig from this hybrid assembly yielded the prDNA/prDNA junction. The presence of the prDNA/prDNA junction in our assembly confirmed the presence of at least two prDNA units in our BAC clone and allowed us to build a complete prDNA-inner unit (see Methods). The assembled prDNA-G and inner prDNA units have sizes of 2,440 bp and 2,607 bp respectively. Both these units are in agreement with their previously published restriction maps [14].

            Specifically, we showed that, comparatively to the 66-p-347 strain, the V.test prDNA-inner unit presents several indels including two large indels in the repetitive PstI region (Figure 5). This PstI-rich repetitive region seems to be the one presenting the most variation as it also presents comparatively large differences between prDNA units within the same strain. Indeed, Bublot et al. [14] roughly determined the size of the V.test major prDNA-inner unit to be around 2,650 bp due to the presence of 4 repetitions of the two small PstI bordered fragments.
            http://static-content.springer.com/image/art%3A10.1186%2F1743-422X-8-406/MediaObjects/12985_2011_1526_Fig5_HTML.jpg
            Figure 5

            The BoHV-4 inner prDNA units contain conserved cleavage/packaging signals. Alignment of the prDNA-inner units from V.test strain (above) and 66-p-347 strain (below). The differences observed in the alignment are highlighted in grey. The cleavage/packaging signals pac-1 and pac-2 are represented in boxes, and their composing C-rich, G-rich, GC-rich and T-rich units are indicated. PstI, EcoRI, SstII, BamHI restriction sites are represented in coloured font.

            In the prDNA-G unit, we established that these two small PstI-bordered fragments make up a fragment of 186 bp and that these are indeed repeated 4 times (Figure 6). In the prDNA-inner unit, we determined that the last PstI-bordered fragment is actually a variation of the 186 bp fragment where the inner Pst-I site is slightly modified (Figure 6). Therefore, the rough 200 bp size discrepancy between the prDNA-G (2,440 bp) and the prDNA-inner units (2,607 bp) is due to the presence of a slightly modified repetition of the previous segment. These results are compatible with the restriction profiles presented in Bublot et al. [14] as detailed by the positions of several restriction sites on Figure 6.
            http://static-content.springer.com/image/art%3A10.1186%2F1743-422X-8-406/MediaObjects/12985_2011_1526_Fig6_HTML.jpg
            Figure 6

            The prDNA-G unit does not present a completepac-2cleavage/packaging signal. Alignment of the prDNA units from V.test strain (prDNA-inner above and prDNA-G below). The differences observed in the alignment are highlighted in grey. The cleavage/packaging signals pac-1 and pac-2 are represented in boxes, and their composing C-rich, G-rich, GC-rich and T-rich units are indicated. PstI, EcoRI, SstII, BamHI restriction sites (here PstI) are represented in coloured font. One modified PstI restriction site in the prDNA-inner is also highlighted to indicate the divergence between the fragments composing both units.

            In addition to the variations in the PstI-bordered repetitions, one of the major differences between the prDNA-inner units and the prDNA-G lies in their 5' end. Indeed, the prDNA-inner contains a conserved pac-2 cleavage/packaging signal in its right terminal region, which is not the case of prDNA-G (Figure 6). Both units however, possess a conserved pac-1 cleavage/packaging signal in their left terminal region. Interestingly, the pac-1 and pac-2 cleavage and packaging signals show a good conservation between 66-p-347 and V.test's inner units, despite the presence of these signals in a repeated region bearing high divergence levels. Broll et al. [15] have determined, by transient cleavage/packaging assay, that a single prDNA unit is sufficient for cleavage and packaging. However, from the absence of a conserved pac-2 motif in the prDNA-G, we suggest that, even if a single inner prDNA unit is indeed sufficient for cleavage and packaging, the prDNA-G alone would not suffice. This would therefore indicate that two prDNA units at least are necessary in the context of naturally occurring BoHV-4 genomes for correct cleavage and packaging. The packaging of herpesvirus genomes is still not fully understood, however, detailed studies in herpes simplex virus type 1 (HSV-1), human and murine cytomegaloviruses (HCMV and MCMV) have highlighted the roles of the major conserved motifs and suggested the following general mechanism by which concatemers are cleaved and packaged [4850]. Firstly, the T-box of the pac-2 signal is essential for the cleavage that initiates DNA packaging. Cleavage occurs at a fixed distance from the pac-2 T-box, and the resulting end that contains the pac-2 GC-box and other cis acting elements is inserted into the procapsid. Packaging is therefore directional and proceeds from pac-2 towards the pac-1 terminus [48]. A second cleavage event, directed by pac-1, then terminates DNA packaging. If we apply this model to BoHV-4, the divergence of the pac-2 signal in prDNA-G, namely the absence of a T-box, indicates that it is not a functional pac-2 initiation signal. As the genome packaging is directional from pac-2 to pac-1 (therefore, from the right to the left end of the genome), the lack of a pac-2 initiation signal in prDNA-G ensures that no packaging would lead to a remaining concatemer lacking a left end prDNA. This would therefore guarantee that genomes bearing at least one left and one right end prDNA unit are encapsulated into virions. This model and its implications will require further investigations in the future.

            Conclusions

            BAC-cloning of the BoHV-4 V.test strain has greatly facilitated the use of this virus as a model for human pathogenic gammaherpesviruses. However, until now, the complete genome sequence of this strain was unavailable. In this study, we have determined the complete genome sequence of the BoHV-4 V.test strain. In comparison with the previously sequenced 66-p-347 strain, we identified important differences in 9 potential open reading frames. Moreover, sequence analyses allowed us to identify genome features that are potentially important for viral replication. All together, these results should have implications for the study of BoHV-4 and herpesviruses in general.

            Declarations

            Acknowledgements

            LP is supported by a post-doctoral fellowship from the University of Liège. BM, CL and LG are Research Fellows and Research Associate of the "Fonds de la Recherche Scientifique - Fonds National Belge de la Recherche Scientifique" (F.R.S. - FNRS), respectively. This work was supported by the following grants: starting grant (D-09/11) and GLYVIR ARC of the University of Liège and scientific impulse grant of the F.R.S. - FNRS n°F.4510.10.

            Authors’ Affiliations

            (1)
            Immunology-Vaccinology (B43b), Department of Infectious and Parasitic Diseases (B43b), Faculty of Veterinary Medicine, University of Liège

            References

            1. Henle G, Henle W, Clifford P, Diehl V, Kafuko GW, Kirya BG, Klein G, Morrow RH, Munube GM, Pike P, et al.: Antibodies to Epstein-Barr virus in Burkitt's lymphoma and control groups. J Natl Cancer Inst 1969, 43:1147–1157.PubMed
            2. Verma SC, Robertson ES: Molecular biology and pathogenesis of Kaposi sarcoma-associated herpesvirus. FEMS Microbiol Lett 2003, 222:155–163.PubMedView Article
            3. Thorley-Lawson DA, Gross A: Persistence of the Epstein-Barr virus and the origins of associated lymphomas. N Engl J Med 2004, 350:1328–1337.PubMedView Article
            4. Davison AJ, Eberle R, Ehlers B, Hayward GS, McGeoch DJ, Minson AC, Pellett PE, Roizman B, Studdert MJ, Thiry E: The order Herpesvirales. Arch Virol 2009, 154:171–177.PubMedView Article
            5. Thiry E, Bublot M, Dubuisson J, Van Bressem MF, Lequarre AS, Lomonte P, Vanderplasschen A, Pastoret PP: Molecular biology of bovine herpesvirus type 4. Vet Microbiol 1992, 33:79–92.PubMedView Article
            6. Bartha A, Juhasz M, Liebermann H: Isolation of a bovine herpesvirus from calves with respiratory disease and keratoconjunctivitis. A preliminary report. Acta Vet Acad Sci Hung 1966, 16:357–358.PubMed
            7. Mohanty SB, Hammond RC, Lillie MG: A new bovine herpesvirus and its effect on experimentally infected calves. Brief report. Arch Gesamte Virusforsch 1971, 33:394–395.PubMedView Article
            8. Rossiter PB, Gumm ID, Stagg DA, Conrad PA, Mukolwe S, Davies FG, White H: Isolation of bovine herpesvirus-3 from African buffaloes (Syncerus caffer). Res Vet Sci 1989, 46:337–343.PubMed
            9. Dewals B, Thirion M, Markine-Goriaynoff N, Gillet L, de Fays K, Minner F, Daix V, Sharp PM, Vanderplasschen A: Evolution of Bovine herpesvirus 4: recombination and transmission between African buffalo and cattle. J Gen Virol 2006, 87:1509–1519.PubMedView Article
            10. Dewals B, Gillet L, Gerdes T, Taracha EL, Thiry E, Vanderplasschen A: Antibodies against bovine herpesvirus 4 are highly prevalent in wild African buffaloes throughout eastern and southern Africa. Vet Microbiol 2005, 110:209–220.PubMedView Article
            11. Zimmermann W, Broll H, Ehlers B, Buhk HJ, Rosenthal A, Goltz M: Genome sequence of bovine herpesvirus 4, a bovine Rhadinovirus, and identification of an origin of DNA replication. J Virol 2001, 75:1186–1194.PubMedView Article
            12. Gillet L, Daix V, Donofrio G, Wagner M, Koszinowski UH, China B, Ackermann M, Markine-Goriaynoff N, Vanderplasschen A: Development of bovine herpesvirus 4 as an expression vector using bacterial artificial chromosome cloning. J Gen Virol 2005, 86:907–917.PubMedView Article
            13. Thiry E, Pastoret PP, Dessy-Doizé C, Hanzen C, Calberg-Bacq CM: Herpesvirus in infertile bull's testicle. Vet rec 1981, 108:426.PubMedView Article
            14. Bublot M, Van Bressem MF, Thiry E, Dubuisson J, Pastoret PP: Bovine herpesvirus 4 genome: cloning, mapping and strain variation analysis. J Gen Virol 1990,71(Pt 1):133–142.PubMedView Article
            15. Broll H, Buhk HJ, Zimmermann W, Goltz M: Structure and function of the prDNA and the genomic termini of the gamma2-herpesvirus bovine herpesvirus type 4. J Gen Virol 1999,80(Pt 4):979–986.PubMed
            16. Margulies M, Egholm M, Altman WE, Attiya S, Bader JS, Bemben LA, Berka J, Braverman MS, Chen YJ, Chen Z, et al.: Genome sequencing in microfabricated high-density picolitre reactors. Nature 2005, 437:376–380.PubMed
            17. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ: Basic local alignment search tool. J Mol Biol 1990, 215:403–410.PubMed
            18. Lomonte P, Bublot M, van Santen V, Keil GM, Pastoret PP, Thiry E: Analysis of bovine herpesvirus 4 genomic regions located outside the conserved gammaherpesvirus gene blocks. J Gen Virol 1995,76(Pt 7):1835–1841.PubMedView Article
            19. Chevreux B, Pfisterer T, Drescher B, Driesel AJ, Muller WE, Wetter T, Suhai S: Using the miraEST assembler for reliable and automated mRNA transcript assembly and SNP detection in sequenced ESTs. Genome Res 2004, 14:1147–1159.PubMedView Article
            20. Ewing B, Green P: Base-calling of automated sequencer traces using phred. II. Error probabilities. Genome Res 1998, 8:186–194.PubMed
            21. Ewing B, Hillier L, Wendl MC, Green P: Base-calling of automated sequencer traces using phred. I. Accuracy assessment. Genome Res 1998, 8:175–185.PubMed
            22. Chou HH, Holmes MH: DNA sequence quality trimming and vector removal. Bioinformatics 2001, 17:1093–1104.PubMedView Article
            23. Staden R, Beal KF, Bonfield JK: The Staden package, 1998. Methods Mol Biol 2000, 132:115–130.PubMed
            24. Marchler-Bauer A, Anderson JB, Chitsaz F, Derbyshire MK, DeWeese-Scott C, Fong JH, Geer LY, Geer RC, Gonzales NR, Gwadz M, et al.: CDD: specific functional annotation with the Conserved Domain Database. Nucleic Acids Res 2009, 37:D205–210.PubMedView Article
            25. Schaffer AA, Wolf YI, Ponting CP, Koonin EV, Aravind L, Altschul SF: IMPALA: matching a protein sequence against a collection of PSI-BLAST-constructed position-specific score matrices. Bioinformatics 1999, 15:1000–1011.PubMedView Article
            26. Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F, Wallace IM, Wilm A, Lopez R, et al.: Clustal W and Clustal × version 2.0. Bioinformatics 2007, 23:2947–2948.PubMedView Article
            27. Team RDC: R: A Language and Environment for Statistical Computing. Vienna: R Foundation for Statistical Computing; 2010.
            28. Charif D, Lobry J: SeqinR 1.0–2: a contributed package to the R project for statistical computing devoted to biological sequences retrieval and analysis. New York: Springer Verlag; 2007.
            29. Cock PJ, Antao T, Chang JT, Chapman BA, Cox CJ, Dalke A, Friedberg I, Hamelryck T, Kauff F, Wilczynski B, de Hoon MJ: Biopython: freely available Python tools for computational molecular biology and bioinformatics. Bioinformatics 2009, 25:1422–1423.PubMedView Article
            30. van Rossum G, Drake F Jr: The Python Language Reference Manual (version 2.5). Network Theory Ltd; 2006.
            31. Machiels B, Lete C, de Fays K, Mast J, Dewals B, Stevenson PG, Vanderplasschen A, Gillet L: Bovine Herpesvirus-4 Bo10 gene encodes a non-essential viral envelope protein that regulates viral tropism through both positive and negative effects. J Virol 2010.
            32. Spatz SJ, Rue CA: Sequence determination of a mildly virulent strain (CU-2) of Gallid herpesvirus type 2 using 454 pyrosequencing. Virus Genes 2008, 36:479–489.PubMedView Article
            33. Elsik CG, Tellam RL, Worley KC, Gibbs RA, Muzny DM, Weinstock GM, Adelson DL, Eichler EE, Elnitski L, Guigo R, et al.: The genome sequence of taurine cattle: a window to ruminant biology and evolution. Science 2009, 324:522–528.PubMedView Article
            34. Wicker T, Schlagenhauf E, Graner A, Close TJ, Keller B, Stein N: 454 sequencing put to the test using the complex genome of barley. BMC Genomics 2006, 7:275.PubMedView Article
            35. Walz N, Christalla T, Tessmer U, Grundhoff A: A global analysis of evolutionary conservation among known and predicted gammaherpesvirus microRNAs. J Virol 2010, 84:716–728.PubMedView Article
            36. Fu M, Deng R, Wang J, Wang X: Detection and analysis of horizontal gene transfer in herpesvirus. Virus Res 2008, 131:65–76.PubMedView Article
            37. Vanderplasschen A, Markine-Goriaynoff N, Lomonte P, Suzuki M, Hiraoka N, Yeh JC, Bureau F, Willems L, Thiry E, Fukuda M, Pastoret PP: A multipotential beta -1,6-N-acetylglucosaminyl-transferase is encoded by bovine herpesvirus type 4. Proc Natl Acad Sci USA 2000, 97:5756–5761.PubMedView Article
            38. Portes-Sentis S, Sergeant A, Gruffat H: A particular DNA structure is required for the function of a cis-acting component of the Epstein-Barr virus OriLyt origin of replication. Nucleic Acids Res 1997, 25:1347–1354.PubMedView Article
            39. Zhu Y, Huang L, Anders DG: Human cytomegalovirus oriLyt sequence requirements. J Virol 1998, 72:4989–4996.PubMed
            40. AuCoin DP, Colletti KS, Xu Y, Cei SA, Pari GS: Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) contains two functional lytic origins of DNA replication. J Virol 2002, 76:7890–7896.PubMedView Article
            41. Rennekamp AJ, Wang P, Lieberman PM: Evidence for DNA hairpin recognition by Zta at the Epstein-Barr virus origin of lytic replication. J Virol 2010, 84:7073–7082.PubMedView Article
            42. Aslani A, Macao B, Simonsson S, Elias P: Complementary intrastrand base pairing during initiation of Herpes simplex virus type 1 DNA replication. Proc Natl Acad Sci USA 2001, 98:7194–7199.PubMedView Article
            43. Russo JJ, Bohenzky RA, Chien MC, Chen J, Yan M, Maddalena D, Parry JP, Peruzzi D, Edelman IS, Chang Y, Moore PS: Nucleotide sequence of the Kaposi sarcoma-associated herpesvirus (HHV8). Proc Natl Acad Sci USA 1996, 93:14862–14867.PubMedView Article
            44. Searles RP, Bergquam EP, Axthelm MK, Wong SW: Sequence and genomic analysis of a Rhesus macaque rhadinovirus with similarity to Kaposi's sarcoma-associated herpesvirus/human herpesvirus 8. J Virol 1999, 73:3040–3053.PubMed
            45. Stamminger T, Honess RW, Young DF, Bodemer W, Blair ED, Fleckenstein B: Organization of terminal reiterations in the virion DNA of herpesvirus saimiri. J Gen Virol 1987,68(Pt 4):1049–1066.PubMedView Article
            46. Lagunoff M, Ganem D: The structure and coding organization of the genomic termini of Kaposi's sarcoma-associated herpesvirus. Virology 1997, 236:147–154.PubMedView Article
            47. Albrecht JC, Nicholas J, Biller D, Cameron KR, Biesinger B, Newman C, Wittmann S, Craxton MA, Coleman H, Fleckenstein B, et al.: Primary structure of the herpesvirus saimiri genome. J Virol 1992, 66:5047–5058.PubMed
            48. Tong L, Stow ND: Analysis of herpes simplex virus type 1 DNA packaging signal mutations in the context of the viral genome. J Virol 2010, 84:321–329.PubMedView Article
            49. Wang JB, McVoy MA: A 128-Base-Pair Sequence Containing the pac1 and a Presumed Cryptic pac2 Sequence Includes cis Elements Sufficient To Mediate Efficient Genome Maturation of Human Cytomegalovirus. J Virol 2011, 85:4432–4439.PubMedView Article
            50. McVoy MA, Nixon DE, Hur JK, Adler SP: The ends on herpesvirus DNA replicative concatemers contain pac2 cis cleavage/packaging elements and their formation is controlled by terminal cis sequences. J Virol 2000, 74:1587–1592.PubMedView Article

            Copyright

            © Palmeira et al; licensee BioMed Central Ltd. 2011

            This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://​creativecommons.​org/​licenses/​by/​2.​0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

            Advertisement