Open Access

Characterization of a circulating PRRSV strain by means of random PCR cloning and full genome sequencing

  • Jan Van Doorsselaere1Email author,
  • Marc Geldhof2,
  • Hans J Nauwynck2 and
  • Peter L Delputte2, 3
Virology Journal20118:160

DOI: 10.1186/1743-422X-8-160

Received: 26 January 2011

Accepted: 10 April 2011

Published: 10 April 2011

Abstract

PRRS is a pig disease of major economic importance that causes respiratory and reproductive problems in pigs. Over the last years it has become clear that PRRSV heterogeneity is increasing. Consequently, this has a potential impact on diagnosis and strategies to counter this disease. The use of sequence-independent PCR techniques for the detection and characterization of PRRSV could be useful to bypass problems associated with the heterogeneity of this virus.

A random PCR cloning approach was tested for the characterization of PRRSV strain 07V063 of unknown genetic background that circulated on a Belgian farm. By using this approach, 7305 bp of sequence data were obtained, distributed randomly across the genome. Using RT-PCR with strain-specific primers, the full length sequence (15014 nt) was obtained. Phylogenetic relationships using ORF5 and ORF1a (NSP2) sequences showed that 07V063 was classified in type 1 subtype 1 and that 07V063 was genetically different from prototype Lelystad Virus (LV). 07V063 showed 87-93% aa identity with LV ORFs coding for structural proteins. Most variation (compared to LV) was noticed in Nsp2 (81% identity) with a deletion of 28 aa. This deletion was different from other known deletions in this ORF. In conclusion, it is shown that this random PCR cloning approach can be used for the characterization of new PRRSV strains of unknown genetic background.

Findings

Porcine reproductive and respiratory syndrome (PRRS) is an economically important viral pig disease in swine producing countries worldwide. The virus can cause reproductive disorders and can give rise to respiratory problems in pigs of all ages [1]. Prevention of the disease is based on a combination of management and vaccination. Evidence is accumulating that PRRSV heterogeneity is affecting the vaccination efficiency. It is suggested that vaccines are only efficacious when the vaccine virus and the challenge virus share a sufficiently high homology [26]. PRRSV heterogeneity was originally considered mainly to occur between European (genotype 1) and American type (genotype 2) PRRSV, but current understanding shows a more complex situation with considerable genetic variability within genotypes [79]. Since such variability may affect the efficacy of vaccination programs and pose an obstacle for PRRSV prevention and control, knowledge on the PRRSV strains circulating on a farm may be essential for choosing an appropriate vaccine [10].

PRRSV diagnosis is mainly based on detection of PRRSV antibodies, Reverse Transcriptase (RT) PCR or virus isolation. Detection of antibodies by ELISA or IPMA is not sufficient to establish the level of PRRSV heterogeneity [11]. RT-PCR allows rapid detection and genotyping of PRRSV, but the high degree of sequence variation observed for PRRSV can influence results obtained by (real-time) RT-PCR and primers and/or probes should be carefully designed based on conserved regions [8, 12]. The development of sequence-independent PCR techniques could be useful for the diagnosis and genotyping of unknown PRRSV isolates and for assessment of the PRRSV heterogeneity of field isolates. Several methods have been developed for the identification of viruses without prior sequence knowledge [13]. For instance, whole genome amplification and random PCR are relatively simple. In both these methods, viral particles (from biological samples or cell culture) are treated with DNAse and RNAse to remove contaminating nucleic acids. RNA and/or DNA from the viral particles is extracted and RNA is reverse transcribed to cDNA using a primer with a random 3'end. Subsequently, cDNA or viral DNA is amplified using a shorter primer (without the 3' random end). This results in DNA fragments of varying size (e.g. 0.5 - 2 Kb) and these fragments can be cloned and sequenced. For instance Allander et al. [14] used random PCR on human respiratory tract samples which allowed identification of several unknown viruses.

The aim of this study was to test a random PCR cloning technique [14] for the detection and genotyping of a PRRSV strain of unknown genetic background.

Random PCR cloning for the identification of PRRSV 07V063

PRRSV 07V063 was isolated from an aborted foetus from a Belgian farm, by inoculation of porcine alveolar macrophages. On this farm, vaccination with Porcilis™ was in place. PRRS diagnosis was confirmed upon detection of cytopathic effect (CPE), and detection of PRRSV antigens by IPMA staining with the nucleocapsid specific mAb P3/27 [15]. The use of a random PCR approach abrogates the need for a priori sequence information and in combination with small scale shotgun sequencing, this can result in viral sequences. Virus 07V063 was grown on MARC-145 cells and concentrated as described [16] and the viral pellet was treated with DNAseI and RNAse. RNA was extracted using commercial kits and used in reverse transcription and random amplification using the tagged random hexanucleotide 5'-GCCGGAGCTCTGCAGATATCNNNNNN-3' for both first- and second strand cDNA synthesis and subsequent amplification of the cDNA with primer 5'-GCCGGAGCTCTGCAGATATC-3' [14]. Random PCR fragments ranging between 500 and 1200 bp were cloned in pCR-Blunt II-TOPO (Invitrogen). Twenty nine clones were sequenced as described [17]. Twenty three clones (80% of the clones) contained PRRS sequences (Table 1). The six other clones showed no match when performing BlastN http://www.ncbi.nlm.nih.gov. The 07V063 sequences were randomly distributed across the PRRSV genome. Several clones were overlapping and six contigs (with sizes between 622 and 2072 bp) were obtained (Figure 1). Thus, without prior knowledge of the sequence it was possible to obtain 7305 bp sequence data using a random PCR cloning approach, hereby confirming PRRS identity.
Table 1

Overview of the sequences from 07V063 obtained by random PCR cloning.

Clone

Size (nt)

Position

% nt identity

49

671

774-1444

81

73

198

1692-1889

89

104

826

1808-2633

89

20

798

2616-3413

86

105

375

3069-3443

88

88

429

3420-3847

93

33

332

3957-4288

91

92

316

6198-6512

93

61

713

6367-7079

93

103

312

6768-7079

94

35

364

6500-6863

93

12

247

8132-8378

89

51

627

8931-9557

86

80

358

9200-9557

87

82

622

11225-11846

87

11

258

11225-11482

86

81

601

11928-12528

92

70

189

12336-12524

94

40

277

12364-12640

90

78

395

12991-13385

90

57

935

13195-14129

91

The position of the sequences is indicated relative to LV. % nt identity is with LV.

https://static-content.springer.com/image/art%3A10.1186%2F1743-422X-8-160/MediaObjects/12985_2011_Article_1275_Fig1_HTML.jpg
Figure 1

PRRSV genome and position of the contigs. The sequences obtained in the random PCR cloning approach were assembled in six contigs (with sizes between 622 and 2072 bp) dispersed over the genome. The contigs are shown with a line.

Full length sequence of 07V063 and comparison with prototype LV

To allow a more detailed evaluation of the PRRSV isolate 07V063, the full length genome sequence was obtained using primers that were based on the 07V063 sequences from the random PCR cloning approach (Table 2). Overlapping amplicons (spanning the complete genome) were obtained using RT-PCR. Both strands of these fragments were directly sequenced. For the amplification of the 3'end, oligodT was used in combination with ORF7fw. A 5' end primer (5'endfw) was designed based on the alignment of genotype 1 strains LV (M96262), EuroPRRS (AY366525), SD01-08 (DQ489311), KNU-07 (FJ349261) and HKEU16 (EU076704). This primer was used in combination with primer Lavgsprev to amplify the 5'end. A full length sequence of 15014 nt was obtained. This sequence was deposited in Genbank (Accession GU737264).
Table 2

Oligonucleotide primers used in RT-PCR amplification and nucleotide sequencing of 07V063

Primer

Sequence

Position

5'endFW

atgatgtgtagggtattccccc

1-22

Orf1univFW

ccctttaaccatgtctggc

111-130

Orf1-1fw

catcc gggtg ctgctgg ctt

336-355

Orf1-2fw

ggag ccaccc acgtgtt gac

681-701

Lav49fw

aatcaatggtattcgtgctg

1072-1091

Orf1-3-fw

tcaat gcctacaa ctgcccg

1631-1650

Orf1-4-fw

cttgta taaa ttgct attgg

1988-2007

Orf1-5-fw

acaa cagg cctc gtaa ggg

2472-2490

Lav73fw

aaaacttggcgctgcacgtc

3102-3121

Orf1-6fw

ggtcc atta gcca gcgcct

3451-3469

Orf1-7fw

cttgag cagcg ccaa cattg

3686-3705

Lav33fw

ggtgttggcacggcgagag

4129-4147

Orf1-8fw

catgg ctgtt gccca agtgt

4538-4557

Orf1-9fw

ttgt gctt acgcc tggccca

4859-4878

Orf1-10fw

ggcgac tcct ataat cgtat

5364-5383

Orf1-11fw

ccaa gcac ttcg cagg tccg

5701-5720

Orf1-12fw

ggctt ggctg ccgaaa tcgg

6096-6115

Orf1-13fw

aatgaa gggag tctt gtcta

6566-6586

Lav92fw

gtgtatccctcggctaccac

6891-6911

Orf1-14fw

catta gtcaa cttcaa ggtt

7280-7299

Orf1-15fw

gga ccc tga gcgg catgaa

7765-7783

Lav12fw

ccaagaactccatggcaggt

8172-8191

Orf1-16fw

ggaaaaacaaattcaaggag

8442-8461

Orf1-17fw

tccag cccatg ctggt ata

8817-8835

Lav51fw

gtgtttgtttcactcacact

9316-9335

Amp6fwint

catcagaccatgtttgacat

9764-9783

Orf1-18fw

aaggc caggaa cacca gggt

10136-10155

Orf1-19fw

cccagta tttgca ccttt gc

10633-10652

Orf1-20fw

cggccgta cttgc aaccag

11132-11150

Orf2afw

gts aca cck tat gatta cg

11387-11406

LavORF2aseqfw

gtgttcgacaacgcccacacgc

11577-11598

Orf3fw

agcc taca gta caa ca ccac

12234-12253

LavORF3seq1fw

agcgttgagctcatcttccc

12261-12280

Orf4fw

cgg ccc ait tcc atccigag

12672-12691

Orf5Pesfw

tga tca cat tcg gtt gct

13320-13337

Orf6fw

tacc aa ctt tc ttc tggac

13838-13856

Orf7fw

tgg cccc tgccc aic acg

14328-14345

Orf1-1-rev

gtcaa cacgt gggtgg ctcc

701-681

Lavgsprev

cgacttgacattctagtcca

900-881

Orf1-2-rev

agat gcca aacgg acgaa cc

1304-1285

Orf1-3-rev

gcag cctt cgga gcag acgc

1796-1777

ORF1-4-rev

cggtg aaca cgag acacc tg

2252-2233

Orf1-5-rev

gctg atgt tgtc ggatt ctg

2615-2596

Orf1-6-rev

ctggg aaca ggagg cgg tgt

3202-3182

Orf1-7-rev

gggttgg atg gagtc gagaa

3730-3711

Lav33rev

ccccaacacttgtgacaacg

3982-3963

Orf1-8rev

gt ccgag tccac tacaatc

4403-4385

Orf1-9rev

agag ttgt gccac tgct gaaa

4755-4735

Amp3intrev2

cagagaaggccggttattcct

5023-5003

Amp3intrev

gattccaatgagatcacca

5609-5591

Orf1-10rev

gctc ggac taaaa cagc tgg

5959-5940

Lav92rev

caccaatgatgatgataggg

6222-6203

Orf1-11rev

cttg caca gaca cagtttt

6720-6702

Orf1-12rev

ttcaa ggca gttg tca ggct

7190-7171

Orf1-13rev

tca ttaa gacg acacc ggaa

7406-7386

Orf1-14rev

cttg ccat cgga cacaa gg

7903-7885

Orf1-15rev

tga cacc actg agcg ccga

8396-8378

Orf1-16rev

agaca cact ggtg acggggt

8696-8676

Lav51rev

aagaaagctgggtttgtcag

8971-8952

Orf1-17rev

cggaa tctg tttcaa cacag

9460-9441

Orf1-18rev

ccagg tggtt gcaa tatcca

9944-9925

Orf1-19rev

aaaactccc gaag ttggtcg

10385-10366

Orf1-20rev

aggc ttgc tgtag tgggcat

10762-10743

Lav82rev

ttcaagctggaagtaggc

11244-11225

Orf1-21rev

tgatttt gctcc acag tgac

11741-11722

Orf2arev

tcatr ccc tatt y tgc acca

12558-12539

Orf3rev

agaa aa gg cacgc ag aaa gca

13184-13165

Orf4rev

cattcagctcgcataicgtcaag

13569-13547

Orf5Pesrev

ggg cgt ata tca tta tag gtg

14100-14079

Orf6rev

acccagc aa ctgg cacag

14606-14589

Orf7rev

tcg ccc taa ttg aa tagg tga

14966-14946

The 5' end and 3'end of 07V063 was 221 nt and 114 nt, respectively. The size of the 5'end of 07V063 is identical with the 5'end of LV with 92.3% identity and 17 nt differences. Several motifs such as the transcription regulatory sequence (UUAACC) and CACCC stretches (involved in binding of host cell transcription factors) are conserved in 07V063 [18]. Table 3 gives an overview of all ORFs in the 07V063 genome and comparison with ORFs from prototype LV. Most variation with LV was noticed in Nsp1 (85% identity/91% similarity) and Nsp2 (81% identity/85% similarity). A major difference is a deletion of 28 aa in a variable region of Nsp2 (at positions 683-710). Similar deletions in this region are known e.g. EuroPRRS has a 17 aa deletion (Figure 2A; [18]). The deletion in NSP2 in 07V63 could be a unique marker for this strain.
Table 3

Comparison of proteins from 07V63 and prototype LV

ORF

Protein

Size 07V63

Size LV

% identity

% similarity

1a

Nsp1

385

385

85

91

 

Nsp2

833

861

81

85

 

Nsp3

447

447

93

96

 

Nsp4

203

203

92

96

 

Nsp5

170

170

96

97

 

Nsp6

16

16

100

100

 

Nsp7

269

269

96

97

 

Nsp8

45

45

100

100

1b

Nsp9

645

645

96

98

 

Nsp10

442

442

94

97

 

Nsp11

224

224

95

97

 

Nsp12

152

152

93

96

2a

GP2

249

249

93

94

2b

E

70

70

95

97

3

GP3

265

265

89

92

4

GP4

183

183

87

93

5

GP5

200

201

91

94

6

M

173

173

93

94

7

N

128

128

91

98

https://static-content.springer.com/image/art%3A10.1186%2F1743-422X-8-160/MediaObjects/12985_2011_Article_1275_Fig2_HTML.jpg
Figure 2

Alignment of Nsp2, ORF4 and ORF5 proteins from 07V063 with LV (ORF4 and ORF5) and a selection of genotype 1 strains (Nsp2). A. Alignment of Nsp2 proteins from genotype 1 strains. Only aa positions 636-755 (LV) are shown. The deletion in 07V063 is located at aa positions 683-710. B. Alignment of GP4 from 07V063 and LV (only the first 120 aa are shown). A neutralizing epitope in LV (57-68) is underlined. C. Alignment of GP5 from 07V063 and LV. A neutralizing epitope in North American strains (37-45) is underlined.

Strain 07V063 showed 87 - 95% aa identity with LV for the structural ORFs 2 - 7. We compared GP4 and GP5 proteins from 07V063 and LV since it has been shown that these proteins are the main target for neutralizing antibodies. Figure 2B shows an alignment of ORF4 proteins. Notably is the high variation in the region 50-70. It has been shown that a neutralizing epitope is present in LV at positions 57-68 [19] and that this region is under antibody-mediated pressure in vitro and in vivo [20, 21]. Pigs infected with 07V063 produce neutralizing antibodies against the 57RVTAAQGRIYTR68 epitope. However, these antibodies do not cross-protect against LV [22]. Similarly, antibodies against the same region in LV, do not cross-protect against 07V063. Interestingly, this lack of cross-neutralization is in agreement with the finding that strain 07V063 was able to replicate and cause disease on a farm where animals were vaccinated with the LV-like Porcilis™ vaccine.

GP5 has been described as the main target for virus-neutralizing antibodies in North American PRRSV strains. A neutralizing epitope has been identified at positions 37-45 [23]. Figure 2C shows that 07V063 and LV have an identical sequence from 37-45 with the exception of an extra glycosylation site at position 37 in 07V063. It has been shown that several strains are glycosylated at this position but the significance of this glycosylation is not known. Other amino acid changes occur throughout the sequence and several of these positions have been described as variable [24]. No other differences in glycosylation pattern of the structural proteins between 07V063 and LV was observed.

Phylogenetic relationship of 07V063

Since ORF5 is frequently used as a marker for the study of genetic relationships [8], we constructed phylogenetic trees using ORF5 sequences from a selection of genotype 1 strains (Table 4). In addition genotype 1 strains for which the full length sequence was available in Genbank were included. VR-2332 (genotype 2) was used as out-group.
Table 4

Overview of strains used for phylogenetic analysis

Strain

Genotype

Genbank Accession ORF5

Genbank Accession ORF1a (nsp2)

VR-2332

2

U87392

U87392

Lelystad

1 (subtype 1)

M96262

M96262

EuroPRRS

1

AY366525

AY366525

01-CB1

1 (subtype 1)

DQ864705

DQ864705

Amervac

1 (subtype 1)

GU067771

GU067771

HKEU16

1 (subtype 1)

EU076704

EU076704

KNU-07

1 (subtype 1)

FJ349261

FJ349261

SHE

1 (subtype 1)

GQ461593

GQ461593

SD01-08

1 (subtype 1)

DQ489311

DQ489311

BJEU06-1

1 (subtype 1)

GU047344

GU047344

NMEU09-1

1 (subtype 1)

GU047345

GU047345

07V063

1 (subtype 1)

GU737264

GU737264

PyrsVac

1 (subtype 1)

DQ324681

ND

Porcilis

1 (subtype 1)

AAW78901

ND

Olot/91

1 (subtype 1)

X92942

ND

Yuz-34

1 (subtype 3)

DQ324692

ND

Bel-42

1 (subtype 3)

DQ324669

ND

Obu-1

1 (subtype 3)

DQ324671

ND

Soz-6

1 (subtype 3)

DQ324686

ND

Dzi-62

1 (subtype 1)

DQ324675

ND

Cresa11

1 (subtype 1)

DQ009626

ND

IV3140

1 (subtype 1)

DQ355821

ND

28639/98

1 (subtype 1)

AY035912

ND

361-4

1 (subtype 1)

AY035915

ND

Sno-4

2 (subtype 2)

DQ324683

ND

Sid

2 (subtype 2)

DQ324682

ND

Aus

2 (subtype 2)

DQ324667

ND

Okt-35

1

DQ324677

ND

16/2000

1

DQ345743

ND

SD02-11

1 (subtype 1)

AY395078

AY383634

SD01-07

1 (subtype 1)

AY395079

AY383632

SD03-12

1 (subtype 1)

AY395074

AY383635

SD03-15

1 (subtype 1)

AY395076

AY383636

It-22

1 (subtype 1)

AY739978

ND

It-39

1 (subtype 1)

AY739995

ND

It-44

1 (subtype 1)

AY740000

ND

It-35

1 (subtype 1)

AY739991

ND

It-13

1 (subtype 1)

AY739969

ND

Lena

1 (subtype 3)

EU909691

ND

The type of the strains is according to Stadejek et al (2008). ND = no data. VR-2332 is genotype 2. Eleven genotype 1 isolates for which full length sequences were obtained are listed first.

Figure 3A shows a phylogenetic tree of ORF5 DNA sequences based on the Neighbour Joining (NJ) method. Several clusters are evident and supported by high bootstrap values. It can be concluded that 07V063 clusters within the pan-European subtype 1 [8]. Within subtype 1, a cluster with LV- and Olot/91-like strains can be distinguished. Although both LV and Olot/91 belong to the earliest PRRSV isolates, still LV and Olot/91-like strains such as SD01-08 are circulating. Strain 07V063 is genetically different from LV- and Olot/91- like strains. Apparently 07V063 clusters together with isolates from different geographical locations e.g. isolates from Spain (16/2000), Denmark (361-4), China (BJEU06-1) and South-Korea (IV3140) although this clustering is not supported by high bootstrap values. A similar tree topology was obtained using ORF5 protein sequences (data not shown). The sub-clustering of type 1 is complex and cannot always be explained by geographic isolation of the strains [8]. The sequence of 07V63 adds to the increase of genetic diversity of type 1 strains and is an example of continuous genetic drift within PRRSV [24]. A recent PRRSV study in Spain [25] demonstrated that Spanish isolates from different years show continuous evolution and increase in heterogeneity and that different genotypes and variants within the genotypes co-circulate.
https://static-content.springer.com/image/art%3A10.1186%2F1743-422X-8-160/MediaObjects/12985_2011_Article_1275_Fig3_HTML.jpg
Figure 3

Phylogenetic relationship of 07V063. Phylogenetic trees were derived from multiple sequence alignments using Phylip v3.67. Bootstrapping was performed 500 times using SEQBOOT. Pairwise distances between DNA and/or protein sequences were determined with DNAdist and PROTdist, respectively. Neighbour-Joining (NJ) trees were calculated with NEIGHBOUR and Maximum Likelyhood (ML) trees with DNAML and PROML. Majority rule consensus trees were calculated using CONSENSE. The percentage confidence is indicated on the branches (500 datasets). Trees, constructed using NJ method, based on ORF5 DNA (A) or ORF1a (Nsp2) DNA (B) sequences. Strain 07V063 is underlined. VR-2332 was used as outgroup.

Also, phylogenetic trees using Nsp2 were constructed (Figure 3B). Sequences from all known full length genotype 1 strains (Table 4) were included. Essentially, the same topology can be observed as for ORF5. A cluster of LV-like strains is evident and supported by high bootstrap values. As was already observed from the ORF5 phylogenetic tree, Amervac and SHE are very closely related as is the case for strains 01-CB1 and LV. 07V063 clusters apart from LV and is genetically distinct from the LV prototype.

Conclusions

By using a simple random PCR cloning approach we obtained PRRSV sequence data from a recent European PRRSV isolate of unknown genetic background. This approach can be used to obtain partial genome sequences from for instance East-European type strains (for which until present, no full length genomes are available) and to get a better knowledge of the increasing PRRSV variability. We also showed that the isolate sequenced in this study is genetically different from prototype LV.

List of abbreviations

PRRSV: 

porcine reproductive and respiratory syndrome virus

RT-PCR: 

reverse transcriptase polymerase chain reaction.

Declarations

Acknowledgements

This work was supported by the Industrial Research Fund (IOF) of Ghent University. The authors would like to thank Ine Vanherpe for technical assistance and Merijn Vanhee for critical reading of the manuscript.

Authors’ Affiliations

(1)
Department of Health Care and Biotechnology, KATHO Catholic University College of South-West Flanders
(2)
Department Virology, Parasitology and Immunology, Faculty of Veterinary Medicine, Ghent University
(3)
ProVaxs, Faculty of Medicine and Health, Ghent University

References

  1. Wensvoort G, de Kluyver EP, Pol JM, Wagenaar F, Moormann RJ, Hulst MM, Bloemraad R, den Besten A, Zetstra T, Terpstra C: Lelystad virus, the cause of porcine epidemic abortion and respiratory syndrome: a review of mystery swine disease research at Lelystad. Vet Microbiol 1992, 33: 185-193. 10.1016/0378-1135(92)90046-VView ArticlePubMed
  2. Cano JP, Dee SA, Murtaugh MP, Trincado CA, Pijoan CB: Effect of vaccination with a modified-live porcine reproductive and respiratory syndrome virus vaccine on dynamics of homologous viral infection in pigs. Am J Vet Res 2007, 68: 565-571. 10.2460/ajvr.68.5.565View ArticlePubMed
  3. Cano JP, Dee SA, Murtaugh MP, Pijoan C: Impact of a modified-live porcine reproductive and respiratory syndrome virus vaccine intervention on a population of pigs infected with a heterologous isolate. Vaccine 2007, 25: 4382-4391. 10.1016/j.vaccine.2007.03.031View ArticlePubMed
  4. Labarque G, Van Reeth K, Nauwynck H, Drexler C, Van Gucht S, Pensaert M: Impact of genetic diversity of European-type porcine reproductive and respiratory syndrome virus strains on vaccine efficacy. Vaccine 2004, 22: 4183-4190. 10.1016/j.vaccine.2004.05.008View ArticlePubMed
  5. Scortti M, Prieto C, Alvarez E, Simarro I, Castro JM: Failure of an inactivated vaccine against porcine reproductive and respiratory syndrome to protect gilts against a heterologous challenge with PRRSV. Vet Rec 2007, 161: 809-813.PubMed
  6. Prieto C, Alvarez E, Martinez-Lobo FJ, Simarro I, Castro JM: Similarity of European porcine reproductive and respiratory virus strains to vaccine strain is not necessarily predictive of the degree of protective immunity conferred. Vet J 2008, 175: 356-363. 10.1016/j.tvjl.2007.01.021View ArticlePubMed
  7. Stadejek T, Oleksiewicz MB, Potapchuk D, Podgorska K: Porcine reproductive and respiratory syndrome virus strains of exceptional diversity in eastern Europe support the definition of new genetic subtypes. J Gen Virol 2006, 87: 1835-1841. 10.1099/vir.0.81782-0View ArticlePubMed
  8. Stadejek T, Oleksiewicz MB, Scherbakov AV, Timina AM, Krabbe JS, Chabros K, Potapchuk D: Definition of subtypes in the European genotype of porcine reproductive and respiratory syndrome virus: nucleocapsid characteristics and geographical distribution in Europe. Arch Virol 2008, 153: 1479-1488. 10.1007/s00705-008-0146-2View ArticlePubMed
  9. Balka G, Hornyak A, Balint A, Kiss I, Kecskemeti S, Bakonyi T, Rusvai M: Genetic diversity of porcine reproductive and respiratory syndrome virus strains circulating in Hungarian swine herds. Vet Microbiol 2008, 127: 128-135. 10.1016/j.vetmic.2007.08.001View ArticlePubMed
  10. Meng XJ: Heterogeneity of porcine reproductive and respiratory syndrome virus: implications for current vaccine efficacy and future vaccine development. Vet Microbiol 2000, 74: 309-329. 10.1016/S0378-1135(00)00196-6View ArticlePubMed
  11. Yoon KJ, Zimmerman JJ, McGinley MJ, Landgraf J, Frey ML, Hill HT, Platt KB: Failure to consider the antigenic diversity of porcine respiratory and reproductive syndrome (PRRS) virus isolates may lead to misdiagnosis. J Vet Diagn Invest 1995, 7: 386-387.View ArticlePubMed
  12. Indik S, Schmoll F, Sipos W, Klein D: Genetic variability of PRRS virus in Austria: consequences for molecular diagnostics and quantification. Vet Microbiol 2005, 107: 171-178. 10.1016/j.vetmic.2005.01.024View ArticlePubMed
  13. Ambrose HE, Clewley JP: Virus discovery by sequence-independent genome amplification. Rev Med Virol 2006, 16: 365-383. 10.1002/rmv.515View ArticlePubMed
  14. Allander T, Tammi MT, Eriksson M, Bjerkner A, Tiveljung-Lindell A, Andersson B: Cloning of a human parvovirus by molecular screening of respiratory tract samples. Proc Natl Acad Sci USA 2005, 102: 12891-12896. 10.1073/pnas.0504666102PubMed CentralView ArticlePubMed
  15. Wieczorek-Krohmer M, Weiland F, Conzelmann K, Kohl D, Visser N, van Woensel P, Thiel HJ, Weiland E: Porcine reproductive and respiratory syndrome virus (PRRSV): monoclonal antibodies detect common epitopes on two viral proteins of European and U.S. isolates. Vet Microbiol 1996, 51: 257-266. 10.1016/0378-1135(96)00047-8View ArticlePubMed
  16. Delputte PL, Nauwynck HJ: Porcine arterivirus infection of alveolar macrophages is mediated by sialic acid on the virus. J Virol 2004, 78: 8094-8101. 10.1128/JVI.78.15.8094-8101.2004PubMed CentralView ArticlePubMed
  17. Karniychuk UU, Geldhof M, Vanhee M, Van Doorsselaere J, Saveleva TA, Nauwynck HJ: Pathogenesis and antigenic characterization of a new East European subtype 3 porcine reproductive and respiratory syndrome virus isolate. BMC Vet Research 2010, 6: 30. 10.1186/1746-6148-6-30View Article
  18. Ropp SL, Mahlum Wees CE, Fang Y, Nelson EA, Rossow KD, Bien M, Arndt B, Preszler S, Steen P, Christopher-Hennings J, Collins JE, Benfield DA, Faaberg KS: Characterization of emerging European-like porcine reproductive and respiratory syndrome virus isolates in the United States. J Virol 2004, 78: 3684-3703. 10.1128/JVI.78.7.3684-3703.2004PubMed CentralView ArticlePubMed
  19. Meulenberg JJ, van Nieuwstadt AP, van Essen-Zandbergen A, Langeveld JP: Posttranslational processing and identification of a neutralization domain of the GP4 protein encoded by ORF4 of the Lelystad Virus. J Virol 1997, 71: 6061-6070.PubMed CentralPubMed
  20. Costers S, Lefebvre DJ, Vanhee M, Geldhof M, Van Doorsselaere J, Delputte PL, Nauwynck HJ: GP4 of porcine reproductive and respiratory syndrome virus contains a neutralizing epitope that is susceptible to immuno-selection in vitro. Arch Virol 2010, 155: 371-378. 10.1007/s00705-009-0582-7View ArticlePubMed
  21. Costers S, Vanhee M, Van Breedam W, Van Doorsselaere J, Geldhof M, Nauwynck H: GP4-specific neutralizing antibodies might be a driving force in PRRSV evolution. Virus Res 2010, 154: 104-113. 10.1016/j.virusres.2010.08.026View ArticlePubMed
  22. Vanhee M, Costers S, Van Breedam W, Geldhof MF, Van Doorsselaere J, Nauwynck HJ: A variable region in GP4 of European-type porcine reproductive and respiratory syndrome virus induces neutralizing antibodies against homologous but not heterologous virus strains. Viral Immunol 2010, 23: 1-11. 10.1089/vim.2010.0025View Article
  23. Ostrowski M, Galeote JA, Jar AM, Platt KB, Osorio FA, Lopez OJ: Identification of neutralizing and nonneutralizing epitopes in the porcine reproductive and respiratory syndrome virus GP5 ectodomain. J Virol 2002, 76: 4241-4250. 10.1128/JVI.76.9.4241-4250.2002PubMed CentralView ArticlePubMed
  24. Pesh S, Meyer C, Ohlinger VF: New insights into the genetic diversity of European porcine reproductive and respiratory syndrome virus (PRRSV). Vet Microbiol 2005, 107: 31-48. 10.1016/j.vetmic.2005.01.028View Article
  25. Prieto C, Vazquez A, Nunez JI, Alvarez E, Simarro I, Castro JM: Influence of time on the genetic heterogeneity of Spanish porcine reproductive and respiratory syndrome virus isolates. Virol J 2009, 180: 363-370.

Copyright

© Van Doorsselaere et al; licensee BioMed Central Ltd. 2011

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Advertisement