Characterization of a circulating PRRSV strain by means of random PCR cloning and full genome sequencing

  • Jan Van Doorsselaere1Email author,

    Affiliated with

    • Marc Geldhof2,

      Affiliated with

      • Hans J Nauwynck2 and

        Affiliated with

        • Peter L Delputte2, 3

          Affiliated with

          Virology Journal20118:160

          DOI: 10.1186/1743-422X-8-160

          Received: 26 January 2011

          Accepted: 10 April 2011

          Published: 10 April 2011

          Abstract

          PRRS is a pig disease of major economic importance that causes respiratory and reproductive problems in pigs. Over the last years it has become clear that PRRSV heterogeneity is increasing. Consequently, this has a potential impact on diagnosis and strategies to counter this disease. The use of sequence-independent PCR techniques for the detection and characterization of PRRSV could be useful to bypass problems associated with the heterogeneity of this virus.

          A random PCR cloning approach was tested for the characterization of PRRSV strain 07V063 of unknown genetic background that circulated on a Belgian farm. By using this approach, 7305 bp of sequence data were obtained, distributed randomly across the genome. Using RT-PCR with strain-specific primers, the full length sequence (15014 nt) was obtained. Phylogenetic relationships using ORF5 and ORF1a (NSP2) sequences showed that 07V063 was classified in type 1 subtype 1 and that 07V063 was genetically different from prototype Lelystad Virus (LV). 07V063 showed 87-93% aa identity with LV ORFs coding for structural proteins. Most variation (compared to LV) was noticed in Nsp2 (81% identity) with a deletion of 28 aa. This deletion was different from other known deletions in this ORF. In conclusion, it is shown that this random PCR cloning approach can be used for the characterization of new PRRSV strains of unknown genetic background.

          Findings

          Porcine reproductive and respiratory syndrome (PRRS) is an economically important viral pig disease in swine producing countries worldwide. The virus can cause reproductive disorders and can give rise to respiratory problems in pigs of all ages [1]. Prevention of the disease is based on a combination of management and vaccination. Evidence is accumulating that PRRSV heterogeneity is affecting the vaccination efficiency. It is suggested that vaccines are only efficacious when the vaccine virus and the challenge virus share a sufficiently high homology [26]. PRRSV heterogeneity was originally considered mainly to occur between European (genotype 1) and American type (genotype 2) PRRSV, but current understanding shows a more complex situation with considerable genetic variability within genotypes [79]. Since such variability may affect the efficacy of vaccination programs and pose an obstacle for PRRSV prevention and control, knowledge on the PRRSV strains circulating on a farm may be essential for choosing an appropriate vaccine [10].

          PRRSV diagnosis is mainly based on detection of PRRSV antibodies, Reverse Transcriptase (RT) PCR or virus isolation. Detection of antibodies by ELISA or IPMA is not sufficient to establish the level of PRRSV heterogeneity [11]. RT-PCR allows rapid detection and genotyping of PRRSV, but the high degree of sequence variation observed for PRRSV can influence results obtained by (real-time) RT-PCR and primers and/or probes should be carefully designed based on conserved regions [8, 12]. The development of sequence-independent PCR techniques could be useful for the diagnosis and genotyping of unknown PRRSV isolates and for assessment of the PRRSV heterogeneity of field isolates. Several methods have been developed for the identification of viruses without prior sequence knowledge [13]. For instance, whole genome amplification and random PCR are relatively simple. In both these methods, viral particles (from biological samples or cell culture) are treated with DNAse and RNAse to remove contaminating nucleic acids. RNA and/or DNA from the viral particles is extracted and RNA is reverse transcribed to cDNA using a primer with a random 3'end. Subsequently, cDNA or viral DNA is amplified using a shorter primer (without the 3' random end). This results in DNA fragments of varying size (e.g. 0.5 - 2 Kb) and these fragments can be cloned and sequenced. For instance Allander et al. [14] used random PCR on human respiratory tract samples which allowed identification of several unknown viruses.

          The aim of this study was to test a random PCR cloning technique [14] for the detection and genotyping of a PRRSV strain of unknown genetic background.

          Random PCR cloning for the identification of PRRSV 07V063

          PRRSV 07V063 was isolated from an aborted foetus from a Belgian farm, by inoculation of porcine alveolar macrophages. On this farm, vaccination with Porcilis™ was in place. PRRS diagnosis was confirmed upon detection of cytopathic effect (CPE), and detection of PRRSV antigens by IPMA staining with the nucleocapsid specific mAb P3/27 [15]. The use of a random PCR approach abrogates the need for a priori sequence information and in combination with small scale shotgun sequencing, this can result in viral sequences. Virus 07V063 was grown on MARC-145 cells and concentrated as described [16] and the viral pellet was treated with DNAseI and RNAse. RNA was extracted using commercial kits and used in reverse transcription and random amplification using the tagged random hexanucleotide 5'-GCCGGAGCTCTGCAGATATCNNNNNN-3' for both first- and second strand cDNA synthesis and subsequent amplification of the cDNA with primer 5'-GCCGGAGCTCTGCAGATATC-3' [14]. Random PCR fragments ranging between 500 and 1200 bp were cloned in pCR-Blunt II-TOPO (Invitrogen). Twenty nine clones were sequenced as described [17]. Twenty three clones (80% of the clones) contained PRRS sequences (Table 1). The six other clones showed no match when performing BlastN http://​www.​ncbi.​nlm.​nih.​gov. The 07V063 sequences were randomly distributed across the PRRSV genome. Several clones were overlapping and six contigs (with sizes between 622 and 2072 bp) were obtained (Figure 1). Thus, without prior knowledge of the sequence it was possible to obtain 7305 bp sequence data using a random PCR cloning approach, hereby confirming PRRS identity.
          Table 1

          Overview of the sequences from 07V063 obtained by random PCR cloning.

          Clone

          Size (nt)

          Position

          % nt identity

          49

          671

          774-1444

          81

          73

          198

          1692-1889

          89

          104

          826

          1808-2633

          89

          20

          798

          2616-3413

          86

          105

          375

          3069-3443

          88

          88

          429

          3420-3847

          93

          33

          332

          3957-4288

          91

          92

          316

          6198-6512

          93

          61

          713

          6367-7079

          93

          103

          312

          6768-7079

          94

          35

          364

          6500-6863

          93

          12

          247

          8132-8378

          89

          51

          627

          8931-9557

          86

          80

          358

          9200-9557

          87

          82

          622

          11225-11846

          87

          11

          258

          11225-11482

          86

          81

          601

          11928-12528

          92

          70

          189

          12336-12524

          94

          40

          277

          12364-12640

          90

          78

          395

          12991-13385

          90

          57

          935

          13195-14129

          91

          The position of the sequences is indicated relative to LV. % nt identity is with LV.

          http://static-content.springer.com/image/art%3A10.1186%2F1743-422X-8-160/MediaObjects/12985_2011_1275_Fig1_HTML.jpg
          Figure 1

          PRRSV genome and position of the contigs. The sequences obtained in the random PCR cloning approach were assembled in six contigs (with sizes between 622 and 2072 bp) dispersed over the genome. The contigs are shown with a line.

          Full length sequence of 07V063 and comparison with prototype LV

          To allow a more detailed evaluation of the PRRSV isolate 07V063, the full length genome sequence was obtained using primers that were based on the 07V063 sequences from the random PCR cloning approach (Table 2). Overlapping amplicons (spanning the complete genome) were obtained using RT-PCR. Both strands of these fragments were directly sequenced. For the amplification of the 3'end, oligodT was used in combination with ORF7fw. A 5' end primer (5'endfw) was designed based on the alignment of genotype 1 strains LV (M96262), EuroPRRS (AY366525), SD01-08 (DQ489311), KNU-07 (FJ349261) and HKEU16 (EU076704). This primer was used in combination with primer Lavgsprev to amplify the 5'end. A full length sequence of 15014 nt was obtained. This sequence was deposited in Genbank (Accession GU737264).
          Table 2

          Oligonucleotide primers used in RT-PCR amplification and nucleotide sequencing of 07V063

          Primer

          Sequence

          Position

          5'endFW

          atgatgtgtagggtattccccc

          1-22

          Orf1univFW

          ccctttaaccatgtctggc

          111-130

          Orf1-1fw

          catcc gggtg ctgctgg ctt

          336-355

          Orf1-2fw

          ggag ccaccc acgtgtt gac

          681-701

          Lav49fw

          aatcaatggtattcgtgctg

          1072-1091

          Orf1-3-fw

          tcaat gcctacaa ctgcccg

          1631-1650

          Orf1-4-fw

          cttgta taaa ttgct attgg

          1988-2007

          Orf1-5-fw

          acaa cagg cctc gtaa ggg

          2472-2490

          Lav73fw

          aaaacttggcgctgcacgtc

          3102-3121

          Orf1-6fw

          ggtcc atta gcca gcgcct

          3451-3469

          Orf1-7fw

          cttgag cagcg ccaa cattg

          3686-3705

          Lav33fw

          ggtgttggcacggcgagag

          4129-4147

          Orf1-8fw

          catgg ctgtt gccca agtgt

          4538-4557

          Orf1-9fw

          ttgt gctt acgcc tggccca

          4859-4878

          Orf1-10fw

          ggcgac tcct ataat cgtat

          5364-5383

          Orf1-11fw

          ccaa gcac ttcg cagg tccg

          5701-5720

          Orf1-12fw

          ggctt ggctg ccgaaa tcgg

          6096-6115

          Orf1-13fw

          aatgaa gggag tctt gtcta

          6566-6586

          Lav92fw

          gtgtatccctcggctaccac

          6891-6911

          Orf1-14fw

          catta gtcaa cttcaa ggtt

          7280-7299

          Orf1-15fw

          gga ccc tga gcgg catgaa

          7765-7783

          Lav12fw

          ccaagaactccatggcaggt

          8172-8191

          Orf1-16fw

          ggaaaaacaaattcaaggag

          8442-8461

          Orf1-17fw

          tccag cccatg ctggt ata

          8817-8835

          Lav51fw

          gtgtttgtttcactcacact

          9316-9335

          Amp6fwint

          catcagaccatgtttgacat

          9764-9783

          Orf1-18fw

          aaggc caggaa cacca gggt

          10136-10155

          Orf1-19fw

          cccagta tttgca ccttt gc

          10633-10652

          Orf1-20fw

          cggccgta cttgc aaccag

          11132-11150

          Orf2afw

          gts aca cck tat gatta cg

          11387-11406

          LavORF2aseqfw

          gtgttcgacaacgcccacacgc

          11577-11598

          Orf3fw

          agcc taca gta caa ca ccac

          12234-12253

          LavORF3seq1fw

          agcgttgagctcatcttccc

          12261-12280

          Orf4fw

          cgg ccc ait tcc atccigag

          12672-12691

          Orf5Pesfw

          tga tca cat tcg gtt gct

          13320-13337

          Orf6fw

          tacc aa ctt tc ttc tggac

          13838-13856

          Orf7fw

          tgg cccc tgccc aic acg

          14328-14345

          Orf1-1-rev

          gtcaa cacgt gggtgg ctcc

          701-681

          Lavgsprev

          cgacttgacattctagtcca

          900-881

          Orf1-2-rev

          agat gcca aacgg acgaa cc

          1304-1285

          Orf1-3-rev

          gcag cctt cgga gcag acgc

          1796-1777

          ORF1-4-rev

          cggtg aaca cgag acacc tg

          2252-2233

          Orf1-5-rev

          gctg atgt tgtc ggatt ctg

          2615-2596

          Orf1-6-rev

          ctggg aaca ggagg cgg tgt

          3202-3182

          Orf1-7-rev

          gggttgg atg gagtc gagaa

          3730-3711

          Lav33rev

          ccccaacacttgtgacaacg

          3982-3963

          Orf1-8rev

          gt ccgag tccac tacaatc

          4403-4385

          Orf1-9rev

          agag ttgt gccac tgct gaaa

          4755-4735

          Amp3intrev2

          cagagaaggccggttattcct

          5023-5003

          Amp3intrev

          gattccaatgagatcacca

          5609-5591

          Orf1-10rev

          gctc ggac taaaa cagc tgg

          5959-5940

          Lav92rev

          caccaatgatgatgataggg

          6222-6203

          Orf1-11rev

          cttg caca gaca cagtttt

          6720-6702

          Orf1-12rev

          ttcaa ggca gttg tca ggct

          7190-7171

          Orf1-13rev

          tca ttaa gacg acacc ggaa

          7406-7386

          Orf1-14rev

          cttg ccat cgga cacaa gg

          7903-7885

          Orf1-15rev

          tga cacc actg agcg ccga

          8396-8378

          Orf1-16rev

          agaca cact ggtg acggggt

          8696-8676

          Lav51rev

          aagaaagctgggtttgtcag

          8971-8952

          Orf1-17rev

          cggaa tctg tttcaa cacag

          9460-9441

          Orf1-18rev

          ccagg tggtt gcaa tatcca

          9944-9925

          Orf1-19rev

          aaaactccc gaag ttggtcg

          10385-10366

          Orf1-20rev

          aggc ttgc tgtag tgggcat

          10762-10743

          Lav82rev

          ttcaagctggaagtaggc

          11244-11225

          Orf1-21rev

          tgatttt gctcc acag tgac

          11741-11722

          Orf2arev

          tcatr ccc tatt y tgc acca

          12558-12539

          Orf3rev

          agaa aa gg cacgc ag aaa gca

          13184-13165

          Orf4rev

          cattcagctcgcataicgtcaag

          13569-13547

          Orf5Pesrev

          ggg cgt ata tca tta tag gtg

          14100-14079

          Orf6rev

          acccagc aa ctgg cacag

          14606-14589

          Orf7rev

          tcg ccc taa ttg aa tagg tga

          14966-14946

          The 5' end and 3'end of 07V063 was 221 nt and 114 nt, respectively. The size of the 5'end of 07V063 is identical with the 5'end of LV with 92.3% identity and 17 nt differences. Several motifs such as the transcription regulatory sequence (UUAACC) and CACCC stretches (involved in binding of host cell transcription factors) are conserved in 07V063 [18]. Table 3 gives an overview of all ORFs in the 07V063 genome and comparison with ORFs from prototype LV. Most variation with LV was noticed in Nsp1 (85% identity/91% similarity) and Nsp2 (81% identity/85% similarity). A major difference is a deletion of 28 aa in a variable region of Nsp2 (at positions 683-710). Similar deletions in this region are known e.g. EuroPRRS has a 17 aa deletion (Figure 2A; [18]). The deletion in NSP2 in 07V63 could be a unique marker for this strain.
          Table 3

          Comparison of proteins from 07V63 and prototype LV

          ORF

          Protein

          Size 07V63

          Size LV

          % identity

          % similarity

          1a

          Nsp1

          385

          385

          85

          91

           

          Nsp2

          833

          861

          81

          85

           

          Nsp3

          447

          447

          93

          96

           

          Nsp4

          203

          203

          92

          96

           

          Nsp5

          170

          170

          96

          97

           

          Nsp6

          16

          16

          100

          100

           

          Nsp7

          269

          269

          96

          97

           

          Nsp8

          45

          45

          100

          100

          1b

          Nsp9

          645

          645

          96

          98

           

          Nsp10

          442

          442

          94

          97

           

          Nsp11

          224

          224

          95

          97

           

          Nsp12

          152

          152

          93

          96

          2a

          GP2

          249

          249

          93

          94

          2b

          E

          70

          70

          95

          97

          3

          GP3

          265

          265

          89

          92

          4

          GP4

          183

          183

          87

          93

          5

          GP5

          200

          201

          91

          94

          6

          M

          173

          173

          93

          94

          7

          N

          128

          128

          91

          98

          http://static-content.springer.com/image/art%3A10.1186%2F1743-422X-8-160/MediaObjects/12985_2011_1275_Fig2_HTML.jpg
          Figure 2

          Alignment of Nsp2, ORF4 and ORF5 proteins from 07V063 with LV (ORF4 and ORF5) and a selection of genotype 1 strains (Nsp2). A. Alignment of Nsp2 proteins from genotype 1 strains. Only aa positions 636-755 (LV) are shown. The deletion in 07V063 is located at aa positions 683-710. B. Alignment of GP4 from 07V063 and LV (only the first 120 aa are shown). A neutralizing epitope in LV (57-68) is underlined. C. Alignment of GP5 from 07V063 and LV. A neutralizing epitope in North American strains (37-45) is underlined.

          Strain 07V063 showed 87 - 95% aa identity with LV for the structural ORFs 2 - 7. We compared GP4 and GP5 proteins from 07V063 and LV since it has been shown that these proteins are the main target for neutralizing antibodies. Figure 2B shows an alignment of ORF4 proteins. Notably is the high variation in the region 50-70. It has been shown that a neutralizing epitope is present in LV at positions 57-68 [19] and that this region is under antibody-mediated pressure in vitro and in vivo [20, 21]. Pigs infected with 07V063 produce neutralizing antibodies against the 57RVTAAQGRIYTR68 epitope. However, these antibodies do not cross-protect against LV [22]. Similarly, antibodies against the same region in LV, do not cross-protect against 07V063. Interestingly, this lack of cross-neutralization is in agreement with the finding that strain 07V063 was able to replicate and cause disease on a farm where animals were vaccinated with the LV-like Porcilis™ vaccine.

          GP5 has been described as the main target for virus-neutralizing antibodies in North American PRRSV strains. A neutralizing epitope has been identified at positions 37-45 [23]. Figure 2C shows that 07V063 and LV have an identical sequence from 37-45 with the exception of an extra glycosylation site at position 37 in 07V063. It has been shown that several strains are glycosylated at this position but the significance of this glycosylation is not known. Other amino acid changes occur throughout the sequence and several of these positions have been described as variable [24]. No other differences in glycosylation pattern of the structural proteins between 07V063 and LV was observed.

          Phylogenetic relationship of 07V063

          Since ORF5 is frequently used as a marker for the study of genetic relationships [8], we constructed phylogenetic trees using ORF5 sequences from a selection of genotype 1 strains (Table 4). In addition genotype 1 strains for which the full length sequence was available in Genbank were included. VR-2332 (genotype 2) was used as out-group.
          Table 4

          Overview of strains used for phylogenetic analysis

          Strain

          Genotype

          Genbank Accession ORF5

          Genbank Accession ORF1a (nsp2)

          VR-2332

          2

          U87392

          U87392

          Lelystad

          1 (subtype 1)

          M96262

          M96262

          EuroPRRS

          1

          AY366525

          AY366525

          01-CB1

          1 (subtype 1)

          DQ864705

          DQ864705

          Amervac

          1 (subtype 1)

          GU067771

          GU067771

          HKEU16

          1 (subtype 1)

          EU076704

          EU076704

          KNU-07

          1 (subtype 1)

          FJ349261

          FJ349261

          SHE

          1 (subtype 1)

          GQ461593

          GQ461593

          SD01-08

          1 (subtype 1)

          DQ489311

          DQ489311

          BJEU06-1

          1 (subtype 1)

          GU047344

          GU047344

          NMEU09-1

          1 (subtype 1)

          GU047345

          GU047345

          07V063

          1 (subtype 1)

          GU737264

          GU737264

          PyrsVac

          1 (subtype 1)

          DQ324681

          ND

          Porcilis

          1 (subtype 1)

          AAW78901

          ND

          Olot/91

          1 (subtype 1)

          X92942

          ND

          Yuz-34

          1 (subtype 3)

          DQ324692

          ND

          Bel-42

          1 (subtype 3)

          DQ324669

          ND

          Obu-1

          1 (subtype 3)

          DQ324671

          ND

          Soz-6

          1 (subtype 3)

          DQ324686

          ND

          Dzi-62

          1 (subtype 1)

          DQ324675

          ND

          Cresa11

          1 (subtype 1)

          DQ009626

          ND

          IV3140

          1 (subtype 1)

          DQ355821

          ND

          28639/98

          1 (subtype 1)

          AY035912

          ND

          361-4

          1 (subtype 1)

          AY035915

          ND

          Sno-4

          2 (subtype 2)

          DQ324683

          ND

          Sid

          2 (subtype 2)

          DQ324682

          ND

          Aus

          2 (subtype 2)

          DQ324667

          ND

          Okt-35

          1

          DQ324677

          ND

          16/2000

          1

          DQ345743

          ND

          SD02-11

          1 (subtype 1)

          AY395078

          AY383634

          SD01-07

          1 (subtype 1)

          AY395079

          AY383632

          SD03-12

          1 (subtype 1)

          AY395074

          AY383635

          SD03-15

          1 (subtype 1)

          AY395076

          AY383636

          It-22

          1 (subtype 1)

          AY739978

          ND

          It-39

          1 (subtype 1)

          AY739995

          ND

          It-44

          1 (subtype 1)

          AY740000

          ND

          It-35

          1 (subtype 1)

          AY739991

          ND

          It-13

          1 (subtype 1)

          AY739969

          ND

          Lena

          1 (subtype 3)

          EU909691

          ND

          The type of the strains is according to Stadejek et al (2008). ND = no data. VR-2332 is genotype 2. Eleven genotype 1 isolates for which full length sequences were obtained are listed first.

          Figure 3A shows a phylogenetic tree of ORF5 DNA sequences based on the Neighbour Joining (NJ) method. Several clusters are evident and supported by high bootstrap values. It can be concluded that 07V063 clusters within the pan-European subtype 1 [8]. Within subtype 1, a cluster with LV- and Olot/91-like strains can be distinguished. Although both LV and Olot/91 belong to the earliest PRRSV isolates, still LV and Olot/91-like strains such as SD01-08 are circulating. Strain 07V063 is genetically different from LV- and Olot/91- like strains. Apparently 07V063 clusters together with isolates from different geographical locations e.g. isolates from Spain (16/2000), Denmark (361-4), China (BJEU06-1) and South-Korea (IV3140) although this clustering is not supported by high bootstrap values. A similar tree topology was obtained using ORF5 protein sequences (data not shown). The sub-clustering of type 1 is complex and cannot always be explained by geographic isolation of the strains [8]. The sequence of 07V63 adds to the increase of genetic diversity of type 1 strains and is an example of continuous genetic drift within PRRSV [24]. A recent PRRSV study in Spain [25] demonstrated that Spanish isolates from different years show continuous evolution and increase in heterogeneity and that different genotypes and variants within the genotypes co-circulate.
          http://static-content.springer.com/image/art%3A10.1186%2F1743-422X-8-160/MediaObjects/12985_2011_1275_Fig3_HTML.jpg
          Figure 3

          Phylogenetic relationship of 07V063. Phylogenetic trees were derived from multiple sequence alignments using Phylip v3.67. Bootstrapping was performed 500 times using SEQBOOT. Pairwise distances between DNA and/or protein sequences were determined with DNAdist and PROTdist, respectively. Neighbour-Joining (NJ) trees were calculated with NEIGHBOUR and Maximum Likelyhood (ML) trees with DNAML and PROML. Majority rule consensus trees were calculated using CONSENSE. The percentage confidence is indicated on the branches (500 datasets). Trees, constructed using NJ method, based on ORF5 DNA (A) or ORF1a (Nsp2) DNA (B) sequences. Strain 07V063 is underlined. VR-2332 was used as outgroup.

          Also, phylogenetic trees using Nsp2 were constructed (Figure 3B). Sequences from all known full length genotype 1 strains (Table 4) were included. Essentially, the same topology can be observed as for ORF5. A cluster of LV-like strains is evident and supported by high bootstrap values. As was already observed from the ORF5 phylogenetic tree, Amervac and SHE are very closely related as is the case for strains 01-CB1 and LV. 07V063 clusters apart from LV and is genetically distinct from the LV prototype.

          Conclusions

          By using a simple random PCR cloning approach we obtained PRRSV sequence data from a recent European PRRSV isolate of unknown genetic background. This approach can be used to obtain partial genome sequences from for instance East-European type strains (for which until present, no full length genomes are available) and to get a better knowledge of the increasing PRRSV variability. We also showed that the isolate sequenced in this study is genetically different from prototype LV.

          List of abbreviations

          PRRSV: 

          porcine reproductive and respiratory syndrome virus

          RT-PCR: 

          reverse transcriptase polymerase chain reaction

          Declarations

          Acknowledgements

          This work was supported by the Industrial Research Fund (IOF) of Ghent University. The authors would like to thank Ine Vanherpe for technical assistance and Merijn Vanhee for critical reading of the manuscript.

          Authors’ Affiliations

          (1)
          Department of Health Care and Biotechnology, KATHO Catholic University College of South-West Flanders
          (2)
          Department Virology, Parasitology and Immunology, Faculty of Veterinary Medicine, Ghent University
          (3)
          ProVaxs, Faculty of Medicine and Health, Ghent University

          References

          1. Wensvoort G, de Kluyver EP, Pol JM, Wagenaar F, Moormann RJ, Hulst MM, Bloemraad R, den Besten A, Zetstra T, Terpstra C: Lelystad virus, the cause of porcine epidemic abortion and respiratory syndrome: a review of mystery swine disease research at Lelystad. Vet Microbiol 1992, 33:185–193.PubMedView Article
          2. Cano JP, Dee SA, Murtaugh MP, Trincado CA, Pijoan CB: Effect of vaccination with a modified-live porcine reproductive and respiratory syndrome virus vaccine on dynamics of homologous viral infection in pigs. Am J Vet Res 2007, 68:565–571.PubMedView Article
          3. Cano JP, Dee SA, Murtaugh MP, Pijoan C: Impact of a modified-live porcine reproductive and respiratory syndrome virus vaccine intervention on a population of pigs infected with a heterologous isolate. Vaccine 2007, 25:4382–4391.PubMedView Article
          4. Labarque G, Van Reeth K, Nauwynck H, Drexler C, Van Gucht S, Pensaert M: Impact of genetic diversity of European-type porcine reproductive and respiratory syndrome virus strains on vaccine efficacy. Vaccine 2004, 22:4183–4190.PubMedView Article
          5. Scortti M, Prieto C, Alvarez E, Simarro I, Castro JM: Failure of an inactivated vaccine against porcine reproductive and respiratory syndrome to protect gilts against a heterologous challenge with PRRSV. Vet Rec 2007, 161:809–813.PubMed
          6. Prieto C, Alvarez E, Martinez-Lobo FJ, Simarro I, Castro JM: Similarity of European porcine reproductive and respiratory virus strains to vaccine strain is not necessarily predictive of the degree of protective immunity conferred. Vet J 2008, 175:356–363.PubMedView Article
          7. Stadejek T, Oleksiewicz MB, Potapchuk D, Podgorska K: Porcine reproductive and respiratory syndrome virus strains of exceptional diversity in eastern Europe support the definition of new genetic subtypes. J Gen Virol 2006, 87:1835–1841.PubMedView Article
          8. Stadejek T, Oleksiewicz MB, Scherbakov AV, Timina AM, Krabbe JS, Chabros K, Potapchuk D: Definition of subtypes in the European genotype of porcine reproductive and respiratory syndrome virus: nucleocapsid characteristics and geographical distribution in Europe. Arch Virol 2008, 153:1479–1488.PubMedView Article
          9. Balka G, Hornyak A, Balint A, Kiss I, Kecskemeti S, Bakonyi T, Rusvai M: Genetic diversity of porcine reproductive and respiratory syndrome virus strains circulating in Hungarian swine herds. Vet Microbiol 2008, 127:128–135.PubMedView Article
          10. Meng XJ: Heterogeneity of porcine reproductive and respiratory syndrome virus: implications for current vaccine efficacy and future vaccine development. Vet Microbiol 2000, 74:309–329.PubMedView Article
          11. Yoon KJ, Zimmerman JJ, McGinley MJ, Landgraf J, Frey ML, Hill HT, Platt KB: Failure to consider the antigenic diversity of porcine respiratory and reproductive syndrome (PRRS) virus isolates may lead to misdiagnosis. J Vet Diagn Invest 1995, 7:386–387.PubMedView Article
          12. Indik S, Schmoll F, Sipos W, Klein D: Genetic variability of PRRS virus in Austria: consequences for molecular diagnostics and quantification. Vet Microbiol 2005, 107:171–178.PubMedView Article
          13. Ambrose HE, Clewley JP: Virus discovery by sequence-independent genome amplification. Rev Med Virol 2006, 16:365–383.PubMedView Article
          14. Allander T, Tammi MT, Eriksson M, Bjerkner A, Tiveljung-Lindell A, Andersson B: Cloning of a human parvovirus by molecular screening of respiratory tract samples. Proc Natl Acad Sci USA 2005, 102:12891–12896.PubMedView Article
          15. Wieczorek-Krohmer M, Weiland F, Conzelmann K, Kohl D, Visser N, van Woensel P, Thiel HJ, Weiland E: Porcine reproductive and respiratory syndrome virus (PRRSV): monoclonal antibodies detect common epitopes on two viral proteins of European and U.S. isolates. Vet Microbiol 1996, 51:257–266.PubMedView Article
          16. Delputte PL, Nauwynck HJ: Porcine arterivirus infection of alveolar macrophages is mediated by sialic acid on the virus. J Virol 2004, 78:8094–8101.PubMedView Article
          17. Karniychuk UU, Geldhof M, Vanhee M, Van Doorsselaere J, Saveleva TA, Nauwynck HJ: Pathogenesis and antigenic characterization of a new East European subtype 3 porcine reproductive and respiratory syndrome virus isolate. BMC Vet Research 2010, 6:30.View Article
          18. Ropp SL, Mahlum Wees CE, Fang Y, Nelson EA, Rossow KD, Bien M, Arndt B, Preszler S, Steen P, Christopher-Hennings J, Collins JE, Benfield DA, Faaberg KS: Characterization of emerging European-like porcine reproductive and respiratory syndrome virus isolates in the United States. J Virol 2004, 78:3684–3703.PubMedView Article
          19. Meulenberg JJ, van Nieuwstadt AP, van Essen-Zandbergen A, Langeveld JP: Posttranslational processing and identification of a neutralization domain of the GP4 protein encoded by ORF4 of the Lelystad Virus. J Virol 1997, 71:6061–6070.PubMed
          20. Costers S, Lefebvre DJ, Vanhee M, Geldhof M, Van Doorsselaere J, Delputte PL, Nauwynck HJ: GP4 of porcine reproductive and respiratory syndrome virus contains a neutralizing epitope that is susceptible to immuno-selection in vitro. Arch Virol 2010, 155:371–378.PubMedView Article
          21. Costers S, Vanhee M, Van Breedam W, Van Doorsselaere J, Geldhof M, Nauwynck H: GP4-specific neutralizing antibodies might be a driving force in PRRSV evolution. Virus Res 2010, 154:104–113.PubMedView Article
          22. Vanhee M, Costers S, Van Breedam W, Geldhof MF, Van Doorsselaere J, Nauwynck HJ: A variable region in GP4 of European-type porcine reproductive and respiratory syndrome virus induces neutralizing antibodies against homologous but not heterologous virus strains. Viral Immunol 2010, 23:1–11.View Article
          23. Ostrowski M, Galeote JA, Jar AM, Platt KB, Osorio FA, Lopez OJ: Identification of neutralizing and nonneutralizing epitopes in the porcine reproductive and respiratory syndrome virus GP5 ectodomain. J Virol 2002, 76:4241–4250.PubMedView Article
          24. Pesh S, Meyer C, Ohlinger VF: New insights into the genetic diversity of European porcine reproductive and respiratory syndrome virus (PRRSV). Vet Microbiol 2005, 107:31–48.View Article
          25. Prieto C, Vazquez A, Nunez JI, Alvarez E, Simarro I, Castro JM: Influence of time on the genetic heterogeneity of Spanish porcine reproductive and respiratory syndrome virus isolates. Virol J 2009, 180:363–370.

          Copyright

          © Van Doorsselaere et al; licensee BioMed Central Ltd. 2011

          This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://​creativecommons.​org/​licenses/​by/​2.​0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

          Advertisement