Complete genome analysis of a frog virus 3 (FV3) isolate and sequence comparison with isolates of differing levels of virulence

  • Elizabeth A Morrison1,

    Affiliated with

    • Shawn Garner1, 2Email author,

      Affiliated with

      • Pierre Echaubard3Email author,

        Affiliated with

        • David Lesbarrères2,

          Affiliated with

          • Christopher J Kyle1 and

            Affiliated with

            • Craig R Brunetti1Email author

              Affiliated with

              Virology Journal201411:46

              DOI: 10.1186/1743-422X-11-46

              Received: 22 October 2013

              Accepted: 6 March 2014

              Published: 12 March 2014

              Abstract

              Background

              Frog virus 3 (FV3) is the type species of the genus Ranavirus, and in the past few decades, FV3 infections have resulted in considerable morbidity and mortality in a range of wild and cultivated amphibian species in the Americas, Europe, and Asia. The reasons for the pathogenicity of FV3 are not well understood.

              Findings

              We investigated three FV3 isolates designated SSME, wt-FV3, and aza-Cr, and reported that our wt-FV3 and aza-Cr strains showed similar levels of virulence, while SSME was the least virulent in an in vivo study with Lithiobates pipiens tadpoles. Using 454 GS-FLX sequencing technology, we sequenced SSME and compared it to the published wt-FV3 genome. SSME had multiple amino acid deletions in ORFs 49/50L, 65L, 66L, and 87L, which may explain its reduced virulence. We also investigated repeat regions and found that repeat copy number differed between isolates, with only one group of 3 isolates and 1 pair of isolates being identical at all 3 locations.

              Conclusions

              In this study we have shown that genetic variability is present between closely related FV3 isolates, both in terms of deletions/insertions, and even more so at select repeat locations. These genomic areas with deletions/insertions may represent regions that affect virulence, and therefore require investigation. Furthermore, we have identified repeat regions that may prove useful in future phylogeographical tracking and identification of ranaviral strains across different environmental regions.

              Keywords

              FV3 454 GS-FLX technology Viral isolates Genetic variation Virulence

              Background

              Global amphibian populations have declined considerably in recent years, in part due to habitat fragmentation, pollution, and the chytrid fungus Batrachochytrium dendrobatidis[1, 2]. More recently, certain members of the family Iridoviridae have also been associated with amphibian decline. The family Iridoviridae is comprised of large, cytoplasmic, double stranded DNA viruses with icosahedral capsids [3], and is divided into five genera: Iridovirus, Chloriridovirus, Lymphocystivirus, Megalocytivirus, and Ranavirus[4]. Specifically linked to amphibian mortality in this family are infectious diseases caused by members of the genus Ranavirus. In past research, ranaviruses received little attention as most infections were deemed subclinical; however, recent ranavirus infections have resulted in considerable morbidity and mortality in a range of wild and cultivated amphibian species in the Americas, Europe, and Asia [58]. It has been reported that 43% of known amphibian die-offs in the USA from 2000 to 2005 were due to ranaviruses [9], and that from 1996–2001 ranaviruses were isolated from most of the amphibian mortality events in North America [10]. Detection of these outbreaks could be due to better surveillance, increased environmental awareness, the mutation of viral species creating highly pathogenic strains, or environmental changes resulting in host immune suppression [11]. Ranaviruses have become a significant cause of death and disease in amphibians, and thus investigation into these viruses is warranted from a virological, commercial, and ecological standpoint [11].

              Frog virus 3 (FV3) is the type species of the genus Ranavirus[4]. FV3′s genome is 105,903 base pairs (bp) comprised of 98 open reading frames (ORFs) [12]. Depending on factors such as strain virulence and host immune response, infection with FV3 may or may not lead to mortality. However, in susceptible amphibians, FV3′s necrotic and apoptotic effects cause systemic, chronic cell death in multiple internal organs, resulting in death of the host within a few days to several weeks [2, 13, 14]. FV3 infection is also marked by cutaneous signs, including ulceration of the skin, and erythema and swelling of the limbs and body. In fatal cases, intracoelomic lesions are often present, including haemorrhages of the kidneys and reproductive organs, and pale, swollen livers [15]. While our understanding of ranavirus pathogenicity has improved over the last decade, there is still a need for the research community to more fully describe the determinants of virulence variation. Elucidation of this area will likely heavily rely on the genetic analysis and comparison of ranaviruses that differ in host range and virulence.

              Genetic comparison of related DNA viruses has proven to be an important tool in classifying viral strains and understanding the epidemiology and evolution of different genotypes [16]. By analyzing genetic differences, researchers can link clinically significant alterations with molecular changes, and better understand viral origins and evolution. Increasingly, new viral strains are being identified based on the systematic analysis of sequence data, including short amino acid insertions, translational stop codons, and single amino acid deletions [17]. Analysis of viral isolates has led to the discovery of new viral genotypes, as well as better understanding of the functional genetic differences among strains [17]. For instance, the entire genome of a virulent strain of duck entiritis virus was recently sequenced and compared to the genomes of an attenuated strain and another virulent strain [18]. The results indicated several nucleotide insertions/deletions and frame-shift mutations effecting ORF initiation or termination [18]. These findings allowed the researchers to identify possible virulence factors and provided information on ORFs that are changed during serial passage.

              In addition to nucleotide insertions/deletions, variation between viral genomes may occur at repeat regions. Eaton et al. [19] identified repetitive sequences in the genomes of various ranaviruses with high copy number variation. Repetitive sequences are commonly classified into one of three groups: macro, mini, or micro satellites [20]. The repeats that we will examine in this study contain less than 400 bp comprised of 9-19 bp repeating units. Thus, we suggest that these repeats are some variation between micro and mini satellites, and for the purposes of our analysis, will be referred to as short tandem repeats (STRs). A selection of these repeat regions will be used to analyze FV3 isolates in order to further investigate the fine scale, genetic differences present in variable regions.

              Past studies on the genetic variation between DNA viral strains have allowed for the detection of minute genetic changes that would otherwise have gone unnoticed. These kinds of changes have proved useful in explaining phenotypic differences and evolutionary histories. The purpose of the present investigation is to narrow our focus even further by comparing the genomes of closely related FV3 isolates, including those with varying levels of virulence. This will be done in an attempt to explore the genetic diversity present in strains of FV3, with the ultimate goal of further elucidating the possible genetic basis behind FV3′s unpredictable infectious behaviour.

              Results

              FV3 strains differ in virulence during in vivo infection

              In order to determine if FV3 strains SSME, wt-FV3, and aza-Cr induced different degrees of infection, L. pipiens tadpoles were exposed to each strain. Tadpoles were exposed to FV3-infected water for 12 h before being transferred to FV3-free water for the remainder of the experiment. The tadpoles were monitored for 41 days, at which time all tadpoles had either died or reached metamorphosis. The results of the survival analysis revealed significant differences in strain effect on tadpole mortality rates (X2 = 21.3, p < 0.01). Although deaths triggered by wt-FV3, aza-Cr, and SSME stocks peaked between 15 and 18 days post infection, overall mortality was higher following infection with wt-FV3 and aza-Cr virus (>96%) than with SSME (84%). Wt-FV3 induced a mortality of 97%, and aza-Cr a mortality rate of 96% (Figure 1). In contrast, SSME infected tadpoles reached a mortality plateau after 28 days, and showed a mortality rate of 84%. The control tadpoles had the lowest mortality, with a rate of 66% after 41 days (Figure 1). These data demonstrate that the closely related FV3 strains, wt-FV3 and aza-Cr[21, 22], are associated with higher mortality than SSME (Figure 1). Of concern was the high mortality seen even in control tadpoles (Figure 1). We did confirm that the control tadpoles, both those that survived and those that died, were ranavirus negative (data not shown). This mortality could be the result of overcrowding of tadpoles during infection. In addition, this mortality is occurring during the first few days of the experiment at a time when the tadpoles are very small and very weak, very sensitive to stressful conditions. At the beginning of the experiment, the tadpoles are transferred from tank to tank that may account for the high mortality rate early on in the experiment or may have resulted in high mortality of a sublethal viral dose.
              http://static-content.springer.com/image/art%3A10.1186%2F1743-422X-11-46/MediaObjects/12985_2013_2551_Fig1_HTML.jpg
              Figure 1

              Variable virulence of three FV3 strains during tadpole infection. Survival analysis of L. pipiens tadpoles over 41 days of infection with aza-Cr (square), SSME (circle), wt-FV3 (triangle), and Control (diamond). Tadpoles were exposed to FV3 strains for 12 hours, and then along with the virus-contaminated water were transferred to a tank of dechlorinated water for the remainder of the experiment. Survival analysis and failure time analysis was done following the Kaplan & Meier product limit method associated with Chi square and Gehan’s Wilcoxon tests [37].

              Genomic sequencing of SSME

              In order to better understand the possible genetic basis of phenotypic variation among strains, we sequenced the SSME strain using 454 GS-FLX technology. Our sequenced genome showed high similarity to the published FV3 sequence (wt-FV3) [12], with a sequence identity of 98.79% and average genome sequencing coverage of 51x. Results revealed that SSME differed from the wt-FV3 genome length of 105,903 bps and ORF number of 98; instead, SSME had a length of 105,070 bps, and a total of 95 predicted ORFs (Table 1). Despite high overall sequence identity between SSME and FV3, marked differences were noted in several regions of the genome (Table 2).
              Table 1

              Description of nucleotide start/stop locations and amino acid length of ORFs in SSME, along with predicted functions

               

              Start/stop (#aa)

               

              ORF

              SSME

              Predicted function/conserved domains

              1R

              272-1042

              Replication factor &/or DNA packing protein

              255aa

              2L

              1649-2629

              Myristylated membrane protein, DUF230 poxvirus protein, TM*

              325aa

              3R

              3436-4752

              IIV6 ORF 229L, SP

              437aa

              4R

              4793-4975

              TM

              59aa

              5R

              5408-6022

              FPV ORF 250, US22, herpes virus early nuclear protein

              203aa

              6R

              6025-6252

              SP*

              74aa

              7R

              7043-7429

              SP

              127aa

              8R

              7521-11402

              DNA-dependent RNA polymerase largest subunit

              1292aa

              9L

              11771-14617

              NTPase, SNF2 family, N-terminal, helicases C-terminal, DEAD/H helicases

              947aa

              10R

              14633-15046

              TM

              136aa

              11R

              15396-15608

              TM

              69aa

              12L

              15674-16567

              Unknown protein, SP

              296aa

              13R

              17108-17314

              SP

              67aa

              14R

              17329-17688

              Unknown protein, SP

              118aa

              15R

              17784-18752

              AAA-ATPase, poxvirus A32

              321aa

              16R

              19032-19859

              Integrase homologue

              274aa

              17L

              20100-21608

              SP

              501aa

              18 L

              21645-21881

              TM

              77aa

              19R

              21933-24515

              Similar to LCDV1 or f10L conserved uncharacterized protein, SP

              859aa

              20R

              24562-25008

              Unknown protein, TM

              147aa

              21L

              25231-25890

              ISKNV ORF 56L-like protein

              218aa

              22R

              26020-28941

              D5 family NTPase, ATPase

              972aa

              23R

              29319-30467

              SP

              381aa

              24Rº

              30877-31947

              SP

              355aa

              25R

              32141-32929

              P31K protein

              261aa

              26R

              32996-33226

              Truncated elf-2α homologue

              75aa

              27R

              33757-36669

              Tyrosine kinase, CAP 10, putative lypopolysaccharide modifying enzyme

              969aa

              28R

              36718-37206

              Unknown protein, SP

              161aa

              29L

              37385-37681

              SP

              97aa

              30R

              37883-38035

              TM

              49aa

              31R

              38097-38516

              SP

              138aa

              32R

              38566-40458

              Neurofilament triplet H1 protein

              629aa

              33R

              40541-40732

              Unknown protein, TM

              62aa

              34R

              40875-41195

              Human parainfluenza virus 1L like protein, TM

              105aa

              35L

              41287-41748

              SP

              152aa

              36L

              41761-42384

              SP

              206aa

              37R

              42778-43413

              NIF/NLI interacting factor

              210aa

              38R

              43554-45251

              Ribonucleoside diphosphate reductase alpha subunit barrel domain

              564aa

              39R

              45357-45707

              Hydrolase of the metallo-beta-lactamase superfamily

              115aa

              40R

              45795-46343

              TM

              181aa

              41R

              46725-50222

              RRV ORF-2-like protein, SP

              1164aa

              42L

              50718-50975

              SP

              84aa

              43R

              50974-51491

              TM

              171aa

              44R

              51512-51697

              SP

              60aa

              45L

              51973-52383

              LCDV1 ORF-88-like protein, SP

              135aa

              46L§

              52437-53000

              RGI 47L-like protein, SSTIV 049L-like protein, Neurofilament triplet H1-like protein, microneme/rhoptry antigen

              186aa

              47L

              53125-53541

              SP

              137aa

              48L

              53544-53795

              SP

              82aa

              49/50L¶

              53904-55451

              LCDV1 ORF 58-like protein, RGI ORF 50L-like protein, SSTIV ORF 052-like protein, SAP DNA binding domain

              514aa

              51R

              55531-57216

              Unknown, SP

              560aa

              52L

              57473-58540

              3-beta-hydroxy-delta 5-C27 steroid oxidoreductase-like protein, TM

              354aa

              53R

              58878-60446

              LCDV1 ORF-20-like protein, SP

              521aa

              54L

              60677-60907

              Nuclear calmodulin-binding protein

              75aa

              55L

              60945-62240

              Helicase-like protein

              430aa

              55R

              61089-62228

              FV3 40-kDa protein, SP

              378aa

              56R

              62328-62765

              SP

              144aa

              57R

              62879-64375

              Phosphotransferase, S-TKc, Serine/Threonine protein kinase

              497aa

              58R

              64700-65413

              SP

              236aa

              59L

              65964-67022

              RGV 9807 unknown protein, SP

              351aa

              60R

              67184-70225

              DNA polymerase-like protein, DNA polymerase family B exonuclease

              1012aa

              61L

              70234-70416

              SP

              59aa

              62L

              70859-74524

              DNA-directed RNA polymerase II second largest subunit RNA polymerase domain 6, 7, 3, 2 beta subunit

              1220aa

              63R

              74903-75397

              dUTPase-like protein

              163aa

              64R

              75522-75809

              Interleukin-1 beta convertase precursor, Caspase-recruitment domain/DEATH

              94aa

              65L#

              N/A

              SP

              66L#

              76106-76157

              SP

              16aa

              67L

              76212-77375

              Ribonucleoside-reductase diphosphate beta subunit-like protein

              386aa

              68R

              77657-77944

              SP

              94aa

              69R

              78080-78346

              Unknown protein, TM

              87aa

              70R

              78364-78738

              SP

              123aa

              71R

              78778-79011

              SP

              76aa

              72L

              79068-79784

              SP

              238aa

              73L

              80232-81206

              NTPase/helicase-like protein

              323aa

              74L

              81381-82493

              SP

              369aa

              75L

              82525-82779

              LITAF/PIG7 possible membrane associated motif in LPS-induced tumor necrosis factor alpha factor, TM

              83aa

              76R

              82842-83063

              SP

              72aa

              77L

              83060-83407

              LCDV ORF 2-like protein, SP

              114aa

              78L

              84007-84645

              SP

              211aa

              79R

              84781-86499

              ATPase-dependent protease

              571aa

              80L

              87122-88237

              Ribonuclease III-like protein

              370aa

              81R

              88293-88571

              Transcription elongation Factor SII, C2C2 zinc finger

              91aa

              82R

              88700-89173

              Immediate-early protein ICP-18

              156aa

              83R

              89623-90267

              Cytosine DNA methyl-transferase

              213aa

              84R

              90652-91389

              LCDV 1-like proliferating cell nuclear antigen, SP

              244aa

              85R

              91464-92051

              Deoxynucleoside kinase

              194aa

              86L

              92441-92626

              SP

              60aa

              87L**

              92979-94778

              Unknown protein, SP

              598aa

              88R

              94811-95263

              Evrl-air-augmenter of liver regeneration

              149aa

              89R

              95331-96497

              SP

              388aa

              90R

              96590-97981

              Major capsid protein

              462aa

              91R

              98105-99292

              Immediate-early protein ICP-46

              394aa

              92R

              99627-99872

              SP

              80aa

              93L

              100054-100221

              SP

              54aa

              94L

              100331-100798

              Regina ranavirus P8.141 C-like protein, TM

              154aa

              95R

              100891-101982

              DNA repair protein RAD2, Xeroderma pigmentosum G N-region, Helix-hairpin-helix, Class 2 (Pol I) family

              362aa

              96R

              102784-103455

              Unknown protein, SP

              222aa

              97R

              103538-103951

              Myeloid cell leukemia protein, MCL-1, TM

              136aa

              98R

              104649-104849

              SP

              65aa

              *Note: SP-surface protein, TM-transmembrane domain.

              ºLoss of original, predicted start codon in SSME; new start codon 27 bp downstream.

              §Loss of original, predicted stop codon in SSME; new stop codon 319 bp upstream.

              ¶39 bp deletion in original 50L ORF of SSME. Loss of ORF 50L’s original, predicted stop codon in SSME; ORFs 49L and 50L are now combined as 49/50L.

              #Deletion of 65L ORF and majority of 66L ORFs in SSME.

              **18 bp deletion in 87L ORF of SSME.

              Table 2

              Genetic variation present within the SSME genome as compared to the wt-FV3 reference genome

              Region

              Change

              Affect

              21,933-24,515 bp

              24 bp substitutions

              24aa substitutions & 9aa insertion in 19R

              27 bp insertion

              30,851 bp

              1 bp substitution

              Loss of a start codon in 24R; new start codon is 27 bp downstream, thus shortening ORF by 9aa

              51,102 bp

              1 bp deletion

              Frameshift mutation in 43R

              52,769 bp

              1 bp deletion

              Frameshift mutation and loss of original stop codon in 46L; new stop codon is 319 bp upstream, thus lengthening 46L

              54,805 bp

              1 bp deletion

              Loss of original stop codon in 50L, leading to the combination of ORFs 49L and 50L

              54,938 bp

              39 bp deletion

              13aa deletion in 49/50L

              76,105 bp

              757 bp deletion

              Deletion of all of 65L and the majority of 66L

              94,712 bp

              18 bp deletion

              6aa deletion in 87L

              10,4050 bp

              67 bp deletion

              67 bp deletion in non-coding region between 97R and 98R

              Genome region involved, nucleotide change, and end affect of the variation is presented.

              Gene variation between ranaviruses

              In order to investigate the possible genetic variation within coding regions and regions of high variability between closely related viral isolates, we compared our sequenced SSME genome with four published ranavirus genomes. The genomes compared included: SSME, wt-FV3 [17], rana grylio iridovirus (RGV) [23], soft-shelled turtle iridovirus (SSTIV) [24], and tiger frog virus (TFV) [25]. We began by focusing our analysis on predicted coding regions, as variation in these areas may have consequences in pathogenicity or the kind of disease a virus causes.

              Upon analysis of selected ranaviral genomes, a 757 bp deletion was discovered in SSME, deleting the entire 65L coding region and the majority of the 66L coding region (Figure 2). This deletion was not present in wt-FV3 or in related ranaviruses RGV, SSTIV, and TFV. However, sequence alignments indicated reorganization of 66L in RGV, SSTIV, and TFV, with a 139 bp insertion found in their corresponding 66L regions (Figure 2). Therefore, there are at least 3 different genomic presentations of this region in ranaviral genomes, making it highly variable among isolates.
              http://static-content.springer.com/image/art%3A10.1186%2F1743-422X-11-46/MediaObjects/12985_2013_2551_Fig2_HTML.jpg
              Figure 2

              65L & 66L deletion in SSME. Alignment of the 64R-66L region across ranaviruses. A 757 bp deletion is present in the SSME genome, spanning from 76,113-76,869 bp in wt-FV3, deleting all of 65L and most of 66L. A 139 bp insertion is also present in the 66L homologous regions of RGV, SSTIV, and TFV genomes.

              Another coding region demonstrating variation was 50L. An in frame deletion of 13 amino acids was found in 50L when compared to wt-FV3, present only in the SSME genome (Figure 3). In addition, 50L had a single nucleotide deletion resulting in a frameshift mutation in SSME, RGV, and SSTIV when compared to wt-FV3. This frameshift mutation resulted in the loss of 50L’s stop codon, which led to the combination of 49L and 50L into a single ORF. These two ORFs merged in frame, creating 49/50L. In contrast, TFV did not have this single nucleotide deletion, nor did it display the merger of its 49L and 50L equivalent ORFs (Figure 3). This is consistent with TFV being the most divergent virus of the group.
              http://static-content.springer.com/image/art%3A10.1186%2F1743-422X-11-46/MediaObjects/12985_2013_2551_Fig3_HTML.jpg
              Figure 3

              Variation in ORF 49/50L. Sequence alignment of the 49/50L region across ranaviruses. A 39 bp deletion is present in the SSME genome, spanning from 54,909-54,947 bp in wt-FV3. A single nucleotide deletion is present in SSME, RGV, and SSTIV, leading to the loss of 50L’s original stop codon and the merger of 49L and 50L into one ORF. Different colours are used to represent the portions of TFV’s ORFs that are homologous to parts of 49L and 50L respectively.

              Further ranaviral gene variation was discovered in 43R in the form of a single nucleotide deletion, resulting in a frameshift mutation. Similar deletions were found in SSME, RGV, SSTIV, and TFV, leading to pronounced differences in amino acid sequences when compared to wt-FV3 (Figure 4). It is worth noting that although SSME, RGV, and SSTIV share the same frameshift mutation the genes are not identical as there are several single amino acid changes that lead to modest variation (Figure 4). In contrast, despite having a similar nucleotide deletion, TFV’s proposed amino acid sequence was markedly different from other analyzed ranaviruses. Another single nucleotide deletion was found in 46L (Tables 1 and 2), which led to the loss of the original stop codon and the extension of the ORF by 319 bps (Tables 1 and 2). This was found in all genomes other than TFV and wt-FV3. These data demonstrate that even between very similar viral genomes, there is considerable gene variation, and that when viruses differ in pathogenicity, it could be related to variation in coding regions.
              http://static-content.springer.com/image/art%3A10.1186%2F1743-422X-11-46/MediaObjects/12985_2013_2551_Fig4_HTML.jpg
              Figure 4

              Variation in 43R ORF. Amino acid sequence alignment of the 43R ORF in ranaviruses. A single nucleotide deletion in SSME, RGV, SSTIV, and TFV led to frameshift mutations, causing significant amino acid variability amongst genomes.

              Repeat regions can vary in copy number between viral isolates

              Genomic sequencing, and subsequent analysis, of SSME in comparison to wt-FV3, provided a general overview of the genetic variation between closely related FV3 isolates, particularly in coding regions. We then decided to explore possible genetic variation in highly variable repeat regions, and thus define these genetic regions with greater inter-strain variability. To achieve this, we chose three repeat regions (suspected to be polymorphic in copy number) to investigate. These regions included: Region 1 (22,499-22,574 bps); Region 2 (52,443-52,747 bps); and Region 3 (54,948-54,986 bps), based on the wt-FV3 sequence. We performed a repeat analysis on our sequenced SSME genome that we had previously evaluated for coding region variability, and reference genomes RGV, SSTIV, and TFV. We also decided to analyze the repeat regions of wt-FV3 and aza-Cr in order to check for repeat number stability between the two strains over the multiple viral passages they have undergone since the creation of aza-Cr in 1987 [22]. In addition, we expanded our analysis to include 6 environmental samples isolated from the same waterway in Manitoulin, Kagawong, ON, Canada. These isolates were designated as: E3, E4, E5, F4, F6, and G4; a lab FV3 sample (ATCC® VR-567™) was also used [26].

              The information acquired through analyzing these repeat regions indicated that variation in repeat copy number is present between ranaviral isolates, including those from one geographic location (Figure 5). In the first region, repeat copy number ranged from 2–5 copies, with 2 copies being the most common and 5 copies being unique to isolate F6. Wt-FV3 and aza-Cr shared a distinctive repeat sequence, containing a G rather than an A at the 9th nucleotide position (Figure 5). Region 2 proved to be more variable than region one, with repeat copy number ranging from 4–18 copies, while Region 3 was found to consist of two repeat sequences. These Region 3 repeats varied in copy number between isolates, with a maximum copy number of 4. However, in some instances, the first sequence of nucleotides characteristic of this region did not repeat (Figure 5).
              http://static-content.springer.com/image/art%3A10.1186%2F1743-422X-11-46/MediaObjects/12985_2013_2551_Fig5_HTML.jpg
              Figure 5

              STR variation summary. Short tandem repeats (STRs) vary between viral isolates at three tested locations. Results reveal three isolates (F4, E5, and E3), and two isolates (wt-FV3 and aza-Cr), that have the same STR copy number at each location. Areas highlighted in blue are full repeats, with their coinciding copy number above. Areas highlighted in green represent a sequence that may/may not repeat but is very similar to the STR that follows it in the genome, and areas highlighted in pink represent nucleotides that differ from the STR found in the majority of ranaviruses analyzed.

              Although copy number variation was present amongst isolates, when samples were compared across all three repeat regions, some were found to be identical; such isolates included F4, E5, and E3 (Figure 5), which were isolated from the same geographic region. In addition, isolates wt-FV3 and aza-Cr were also found to be identical across repeat regions (Figure 5), which is consistent with their common origin [22]. This data taken as a whole suggests that viral isolates, even those from one geographic location, can display both variation and identical patterns across repetitive regions of the genome. Thus, these repeats could act as a fingerprint to discriminate between viral isolates.

              Discussion

              Our analysis of related ranaviruses presents a novel approach to genomic comparison that differs from other studies. We analyzed the genomes of closely related isolates of FV3 through 454 GS-FLX technology and STR comparison. The scale (fully sequenced genomes), and the nature of comparison (using viral isolates of FV3), set our investigation apart from past studies. We found that the 3 strains we examined displayed slightly different levels of virulence during in vivo studies. By sequencing the one genome yet to be sequenced, we were able to highlight areas that may be important in generating infectious phenotypes of FV3. This kind of analysis has never been done for FV3 or related ranaviruses: thus, it provides greater insight into the genetic variation among these closely related DNA viruses and the possible genetic basis of ranaviral virulence.

              Our results demonstrate that genetic variation is present between closely related FV3 isolates in both coding and non-coding regions. The SSME genome was sequenced and compared to the published wt-FV3 genome, along with related ranaviral genomes RGV, SSTIV, and TFV. Comparisons revealed that SSME was divergent from wt-FV3, and aza-Cr. This variation could be due to the fact that SSME was isolated from a spotted salamander rather than anurans, and so the strain may have evolved in order for it to better adapt to its novel host, as is seen during serial passage [27]. For example, the pathogenicity of Dengue virus was altered by serial passaging Dengue virus 27 times which resulted in 25 nucleotide changes between 2 strains [27]. This finding is interesting given the fact that our results also showed that SSME was the least virulent of our 3 strains during an in vivo study in anurans (Figure 1). Thus, genetic mutations observed in SSME, such as deletions in ORFs 65L, 66L and 49/50L, could have had an effect on strain virulence in anuran hosts. Also, past sequencing results [12] as well as our own genomic sequencing of wt-FV3 and aza-Cr genomes revealed only 13 nucleotide differences (data not shown) between the strains, supporting our in vivo finding that the two strains cause essentially the same amount of tadpole mortality (97% and 96% respectively).

              One of the most significant genetic variations found in SSME was a 757 bp deletion that deleted all of the 65L coding region and most of the 66L coding region (Figure 2). Among other ranaviruses, the functions of these genes have not been determined. Further sequencing of ranaviruses has shown that 65L is present in both RGV and SSTIV as 69L and 68L respectively [23, 28], while this form of 66L appears to be unique to FV3, as other ranaviruses have a 139 nucleotide insertion in their related 66L regions (Figure 2). Another genetic variation specific to SSME was a 13 amino acid deletion in ORF 50L (Figure 3). Interestingly, a second variation was found in this area in the form of single nucleotide deletion. This deletion lead to the merger of ORFs 49L and 50L in all examined ranaviruses other than TFV and wt-FV3 (Figure 3). In terms of function, 49L has multiple SAP motifs, which are DNA/RNA binding domains predicted to be involved in chromosomal organization and DNA replication [29]. Thus, this new 49/50L ORF may function in viral replication.

              Single nucleotide deletions were found in multiple ranaviruses within the 43R genes (Figure 4) and 46L (Tables 1 and 2) genes. In 43R, the deletion was present in all ranaviruses analyzed other than wt-FV3, and resulted in a frameshift mutation (Figure 4). In 46L, the original stop codon was lost, leading to the extension of the ORF by 319 bps (Tables 1 and 2). This was found in all genomes other than TFV and wt-FV3. Supposedly, 46L encodes for a neurofilament triplet H1-like protein [12]. However, the extended version of 46L that we discovered has a putative conserved domain known as a microneme/rhoptry antigen in the area previously thought to be non-coding. Micronemes and rhoptries are organelles possessed by Apicomplexa protozoans that secrete proteins involved in parasite entry into a host cell, specifically possessing protein-binding motifs that recognize ligands on the host cell surface [30]. Although usually associated with protozoan parasites, these microneme/rhoptry antigens found in 46L could give further indication as to 46L’s function.

              The changes present in 43R, 46L, 49/50L, 65L, and 66L represent the main variable regions amongst the related ranaviral isolates we analyzed. This suggests that these are changeable areas across ranaviruses, and could be used in the future to help explain variable infectious phenotype. Moreover, multiple amino acid deletions present in 65L, 66L, and 49/50L, were limited to the SSME strain, which displayed the lowest level of virulence during tadpole infection. Thus, changes that are unique to SSME may present areas of the genome that are particularly effective in viral attenuation, specifically in an alternative host. As FV3 mortality and morbidity continues to worsen and fluctuate across environmental regions, examination of these genomic areas may prove useful as an initial way to investigate the genetic basis behind infective changes [6]. Further research could be used to explain variations in the virulence of different FV3-like isolates.

              As we had already identified variation in the coding regions of closely related FV3 isolates, we decided to further our understanding of variation within highly variable sites by investigating 3 recently identified STR regions [19]. These are known to be variable areas: for instance, although FV3 and SSTIV share 99% genome sequence identity, they share only approximately 50% of repeats in common [19]. Thus, we predicted that these repeat regions would have greater inter-strain variability that would provide useful information when trying to understand overall genetic variability between ranaviral isolates. In order to test this prediction, we analyzed our sequenced SSME genome and reference ranaviral genomes, along with 6 environmental samples isolated from the same waterway. We also sequenced wt-FV3 and aza-Cr to check for repeat number stability across their past viral passages. Analysis revealed that repeat copy number was variable between isolates, even between those from the same geographic location, but that there was some conservation (Figure 5). Specifically, wt-FV3 and aza-Cr were identical, and samples F4, E5, and E3 were also identical at all three regions (Figure 5); this finding was not surprising given that aza-Cr is the result of the wt-FV3 strain treated with azacytidine and does not necessarily represent a strain with a separate evolutionary history [22]. It also implies stability in the repeat regions, as these regions have not changed between the two strains since their initial separation. However, the finding that viral isolates from the same geographical area have variability may limit the use of STRs as a geographic marker. This STR analysis allowed us to better quantify the small scale genetic variation that is present in highly variable genetic sites amongst FV3 isolates, thus furthering our understanding of genetic variation beyond coding regions.

              The STR analysis we performed in our study has the potential to contribute to our understanding of FV3 tracking and strain designation. Surveillance and phylogeographical analysis of FV3 are pivotal in understanding how the pathogen varies between different habitat sites and amphibian species, as well as for revealing possible sources of a disease outbreak [31]. It can also have direct effects on conservation by aiding in strategy development to minimize die-offs in high-risk areas, and in creating vaccines through knowledge of the FV3 genome itself [14, 31]. However, exact taxonomic identification of viruses in amphibian populations has been difficult given the lack of detailed molecular data on FV3 and other ranaviruses. The methodology used to classify these viruses in the past has been through comparing the major capsid protein (MCP) of different viral isolates [3]. However, the use of the MCP as a tool to distinguish between different ranaviruses, as well as between different strains of the same virus, has been called under scrutiny [24, 32, 33]. Thus, there is a need to develop new methods of strain tracking for ranaviral isolates.

              The use of STRs for ranavirus strain identification has precedence in other virus studies. In one such study, 12 isolates of human cytomegalovirus (HCMV) were isolated from various individuals infected with the virus. The isolates were then tested for variable repeats in 24 polymorphic regions, and based on this analysis, each viral isolate was designated as an individual strain of HCMV [34]. Many of the HCMV repeats used in this study were found in non-coding regions of the genome, similarly to the ones used in our study. The study suggested that these changes in repeats are evolutionarily neutral and so appropriate for strain identification, not only in HCMV, but in other similar, large genome DNA viruses [34].

              Other studies have used coding instead of non-coding repeat regions to identify viral strains [35, 36]. In our study, Region 1 is found in the 19R ORF, unlike the non-coding areas of Regions 2 and 3. There are many examples of functional microsatellites that are known to affect viral characteristics based on copy number, including hepatitis C virus and vesicular stomatitis virus [35, 36]. Therefore, in addition to being potentially useful in viral tracking, STRs from the Region 1 coding region may have functional significance in FV3.

              Conclusions

              In this study we have been able to uncover fine scale genetic variation between closely related ranaviral isolates that have different levels of virulence. We have shown that substantial genetic variability is present between closely related FV3 isolates, both in terms of deletions/insertions, and even more so at select STR locations. These genomic areas with deletions/insertions may present regions that affect viral infectious phenotype, and therefore require investigation. Furthermore, we have identified STR regions that may prove useful in future phylogeographical tracking and identification of ranaviral strains across different environmental regions. As FV3 leads to more unexplained lethal infections in amphibian populations, studies such as this are necessary. The genetic insight that they provide into ranaviral genomes will prove invaluable when seeking to explain the variability of FV3 infectious phenotype in wild populations, and in preventing the devastation that ensues.

              Material and methods

              Reagents, viruses

              FV3 isolate SSME, wt-FV3, and aza-Cr, were analyzed in this study and were provided by Professor Gregory Chinchar from the University of Mississipi Medical Center (Jackson, MS, USA). SSME was isolated from a wild, spotted salamander population in Maine, USA, while aza-Cr was derived from the laboratory wt-FV3 strain through selection with azacytidine [22]. Both wt-FV3 and aza-Cr have been previously sequenced and found to be identical, with wt-FV3′s nucleotide sequence deposited into GenBank [12]. Amphibian renal cells (A6 cells) were supplied by Niels Bols of the University of Waterloo and maintained in Leibovitz’s L-15 media (Invitrogen, Burlington, ON) supplemented with 10% fetal bovine serum (FBS; Invitrogen, Burlington, ON), penicillin (100 U/ml), and streptomycin (100 μg/ml).

              Infection of tadpoles with FV3

              In order to monitor survival of FV3 infected tadpoles, we obtained Lithiobates pipiens tadpoles, approximately Gosner stage 25 [37], from the Environment Canada Atlantic Laboratory for Environmental Testing in Moncton, NB., courtesy of Paula Jackman. The animals were received two weeks prior the beginning of the experiment and were kept in 20 L tanks filled with 10 L of aged clean dechlorinated water. Each treatment group was done as 2 replicates of 25 tadpoles per treatment. Groups tadpoles were placed in dechlorinated water, with the host density (number of tadpoles per volume of water) adjusted to 1 tadpole per 250 mL to avoid any effect of density on tadpole development [38]. To infect, 25 tadpoles were placed in 50 mL of infected water containing 10,000 pfu/mL of a FV3 strain (SSME, wt-FV3, and aza-Cr). According to past experiments, such concentration is known to induce sublethal effects in these laboratory conditions [38]. Control individuals were placed within 50 ml of FV3-free water. The tadpoles were left within the infected solution overnight (12 hours) tadpoles were then transferred together with the contaminated water in 2 L plastic containers filled with 1 L of dechlorinated water (aged for three days) for the rest of the experiment. Containers were held in a climatic chamber (Thermo Incubator Model 3740) where the temperature was set to remain at 22°C with a 12 h:12 h dark:light cycle. Tadpoles were fed on a weekly basis after the water was changed with standard tadpole food (Carolina Biological Supply Company, Burlington, NC) at 30 mg/tadpole for week 1, 60 mg/tadpole for week 2, and 120 mg/tadpole for week 3 until the end of the experiment [38]. Starting on week 3 the water in each tank was replaced once a week with clean dechlorinated aged (24 h) water. As a result, exposed tadpoles were held in virus-containing water for 3 weeks, a period which is long enough for tadpoles to be in close proximity with residual infection [38]. Tanks were monitored on a daily basis. Dead tadpoles were removed to prevent any scavenging, and stored at −25°C in individual plastic vials with ethanol for subsequent analyses.. The experiment terminated when all the individuals died or reached metamorphosis. The procedures used in this experiment follow protocol #2010-04-02 approved by the Laurentian University Animal Care Committee.

              Screening of tadpoles for FV3

              In order to check for ranavirus infection, all animals (including euthanized ones) were dissected to remove the liver that was then crushed into a 1.5 ml Eppendorf tube. The resulting tissue mixture was used for DNA extraction. DNA was extracted using QIAmp DNeasy Kit following the standard protocol (Qiagen). After extraction, a double blind PCR was performed using a primer set known to successfully amplify a portion of the major capsid protein within the FV3 genome: MCP-ranavirus-F (5′-GACTTGGCCACTTATGAC-3′) and MCP-ranavirus-R (5′- GTCTCTGGAGAAGAAGAA), following the PCR conditions listed in Mao et al. [33], using 1.5 μl of template DNA and cycled 40 times. Individuals showing two positive amplifications for both PCRs were considered infected. We analyzed host survival using a survival analysis and failure time analysis following the Kaplan & Meier product limit method associated with Chi square and Gehan’s Wilcoxon tests (multiple and two sample comparisons respectively) [39]. Individuals surviving to the end of the experiment were censored to account for our lack of information about their true time of death [40].

              Viral DNA isolation

              The SSME viral isolate was propagated on a confluent monolayer of A6 cells, and grown in a 75 cm2 flask, with cells infected at a multiplicity of infection (MOI) of 1 PFU/cell. The cells were harvested 5 days post infection (once cytopathic effect appeared), and viral DNA was extracted using the Purelink Viral RNA/DNA Mini Kit according to manufacturer’s protocol (Invitrogen, Burlington, ON).

              Viral genome sequencing

              Standard kits and protocols developed by the manufacturer were used to sequence the SSME sample on a 454 GS-FLX platform (Roche Diagnostics Corporation). Briefly, a Rapid Library Preparation Kit (Roche, Mississauga, ON) was used to mechanically shear 500 ng of template DNA into short fragments. A universal sequencing primer that included a short DNA sequence unique to the sample (MID tag) was then annealed to both ends of each DNA fragment. A GS Junior Titanium Emulsion PCR Kit (Roche, Mississauga, ON) was used to amplify the sample library, which was sequenced using a GS Junior Titanium Sequencing Kit (Roche, Mississauga, ON). In order to assemble a full genomic sequence, the short sequences produced by 454 sequencing were aligned with the reference FV3 genome, wt-FV3, using GS Reference Mapper (Roche, Mississauga, ON). Any gaps in the assembled genome were then sequenced using custom PCR primers specific to each gap, with sequencing performed by the Robarts Sequencing Facility (London, ON). The final genomic sequence was deposited in GenBank accession number KJ175144.

              FV3 sample collection

              FV3 environmental samples were collected from frogs caught by hand at various sites along a lakeshore in Manitoulin, Kagawong, ON, Canada (Latitude: 45.86418, Longitude: −82.27150). The frogs were caught using disposable gloves which were changed between each animal inspection. This method is preferred to the ‘net-catching method’ as it has been suggested that cross contamination can occur via the net. Each individual was toe clipped following the protocol #2009-03-04 approved by the Laurentian University Animal Care Committee for tissue sample collection. DNA was then isolated from toe clippings using the DNeasy Blood & Tissue Kit according to the manufacturer’s protocol for total DNA extraction from animal tissues (Qiagen, Mississauga, ON). Samples then underwent PCR with primers designed to amplify specific repeat regions identified in Eaton et al. [19]. Primers used included: Region 1-F: CGTGGTCAGACTGGTCCTCG; Region 1-R: CACCTCTGTCTCTGAATCGG; Region 2-F: GAGTTTACTTGGTGGCCATG; Region 2-R: TCCTGTCAAGAGATCCCCTC; Region 3-F: CTTGCTGCTGCCGTTCAGGC; and Region 3-R: AGAGTGAAAAAGGTAAAGGC.

              Sequencing repeats and confirming 454 sequence reads

              In a PCR reaction tube the following reactants were combined: 10X PCR buffer (Invitrogen, Burlington, ON), 50 mM MgCl2 solution (Invitrogen, Burlington, ON), 5X TAQ DNA polymerase (Invitrogen, Burlington, ON), 10 mM deoxyribonucleotide triphosphates (dNTPs), 0.1 mM primer, 2.5 ng DNA, and water to a final volume of 50 μl. The reactions were then placed in a thermocycler under the following conditions: 94°C for 3 minutes, 94°C for 30 seconds, 56°C for 1 minute, and 72°C for 1 minute for 30 cycles. Sequences of PCR products were determined by Robarts Research Institute DNA Sequencing Facility in London, ON, and were analyzed using BioEdit v7.0.5.

              Declarations

              Acknowledgements

              This work was supported by Discovery Grants (Natural Science and Engineering Research Council (NSERC) of Canada) to CRB, CJK, and DL. EAM is the recipient of a NSERC postgraduate scholarship and past recipient of a NSERC Undergraduate Research Award.

              Authors’ Affiliations

              (1)
              Department of Biology, Trent University
              (2)
              Department of Biology, Western University
              (3)
              Genetics and Ecology of Amphibians Research Group (GEARG), Department of Biology, Laurentian University

              References

              1. Berger L, Speare R, Daszak P, Green DE, Cunningham AA, Goggin CL, Slocombe R, Ragan MA, Hyatt AD, McDonald KR, Hines HB, Lips KR, Marantelli G, Parkes H: Chytridiomycosis causes amphibian mortality associated with population declines in the rain forests of Australia and Central America. Proc Natl Acad Sci U S A 1998, 95:9031–9036.View ArticlePubMed CentralPubMed
              2. Daszak P, Berger L, Cunninham AA, Hyatt AD, Green DE, Speare R: Emerging infectious diseases and amphibian population declines. Emerg Infect Dis 1999, 5:735–748.View ArticlePubMed CentralPubMed
              3. Tidona CA, Schnitzler P, Kehm R, Darai G: Is the major capsid protein of iridoviruses a suitable target for the study of viral evolution? Virus Genes 1998, 16:59–66.View ArticlePubMed
              4. King A, Adams M, Carstens E, Lefkowitz E: Family Iridoviridae, In: Virus Taxonomy: Ninth Report of the International Committee on Taxonomy of Viruses. San Diego: Academic Press; 2012. pp 193–207
              5. Daszak P, Cunningham A, Hyatt H: Infectious disease and amphibian population declines. Divers Distrib 2003, 9:141–150.View Article
              6. Lesbarrères D, Balseiro A, Brunner J, Chinchar VG, Duffus A, Kerby J, Miller DL, Robert J, Schock DM, Waltzek T, Gray MJ: Ranavirus: past present and future. Biol Lett 2012, 8:481–483.View ArticlePubMed CentralPubMed
              7. Marsh IB, Whittington RJ, O’Rourke B, Hyatt AD, Chisholm O: Rapid differentiation of Australian, European and American ranaviruses based on variation in major capsid protein gene sequence. Mol Cell Probes 2002, 16:137–151.View ArticlePubMed
              8. Stuart SN, Chanson JS, Cox NA, Young BE, Rodrigues AS, Fischman DL, Waller RW: Status and trends of amphibian declines and extinctions worldwide. Science 2004, 306:1783–1786.View ArticlePubMed
              9. Muths E, Gallant AL, Campbell Grant EH, Battaglin WA, Green DE, Staiger JS, Walls SC, Gunzburger MS, Kearney RF: The amphibian research and monitoring initiative (ARMI): 5-year report. US Geological Survey. Sci Invest Rep 2006, 5224:77.
              10. Green DE, Converse KA, Schrader AK: Epizootiology of 64 amphibian morbidity and mortality events in the USA, 1996–2001. Ann N Y Acad Sci 2002, 969:323–339.View ArticlePubMed
              11. Chinchar V, Ranavirus (family Iridoviridae): Emerging cold-blooded killers. Arch Virol 2002, 147:447–470.View ArticlePubMed
              12. Tan W, Barkman T, Chinchar V, Essani K: Comparative genomic analyses of frog virus 3, type species of the genus Ranavirus (family Iridoviridae). Virology 2004, 323:70–84.View ArticlePubMed
              13. Chinchar VG, Bryan L, Wang J, Long S, Chinchar GD: Introduction of apoptosis in frog virus 3-infected cells. Virology 2003, 306:303–312.View ArticlePubMed
              14. Williams T, Barbosa-Solomieu V, Chinchar GD: A decade of advances in iridovirus research. In Advances in virus research, Volume 65. Edited by: Maramorosch K, Shatkin A. New York: Academic Press; 2005:173–248.View Article
              15. Cunningham AA, Langton TE, Bennett PM, Lewin JF, Drury SE, Gough RE, Macgregor SK: Pathological and microbiological findings from incidents of unusual mortality of the common frog ( Rana temporaria ). Philos Trans R Soc Lond B 1996, 351:1539–1557.View Article
              16. Kidd-Ljunggren K, Miyakawa Y, Kidd A: Genetic variability in hepatitis B viruses. J Gen Virol 2002, 83:1267–1280.PubMed
              17. Stuyver L, De Gendt S, Van Geyt C, Zoulim F, Fried M, Schinazi RF, Rossau R: A new genotype of hepatitis B virus: complete genome and phyogenetic relatedness. J Gen Virol 2000, 81:67–74.PubMed
              18. Wang J, Hoper D, Beer M, Osterrieder N: Complete genome sequence of virulent duck enteritis virus (DEV) strain 2085 and comparison with genome sequences of virulent and attenuated DEV strains. Virus Res 2011, 160:316–325.View ArticlePubMed
              19. Eaton HE, Ring BA, Brunetti CR: The genomic diversity and phylogenetic relationship in the family Iridoviridae . Viruses 2010, 2:1458–1475.View ArticlePubMed CentralPubMed
              20. Kass D, Batzer M: Genome organization/human. Life Sciences: Encyclopedia of; 2001:1–8.
              21. Chinchar V, Granoff A: Temperature-sensitive mutants of frog virus 3: biochemical and genetic characterization. J Virol 1986, 58:192–202.PubMed CentralPubMed
              22. Essani K, Goorha R, Granoff A: Mutation in a DNA-binding protein reveals an association between DNA-methyltransferase activity and a 26,000-Da polypeptide in frog virus 3-infected cells. Virology 1987, 161:211–217.View ArticlePubMed
              23. Lei X, Ou T, Zhu R, Zhang Q: Sequencing and analysis of the complete genome of Rana grylio virus (RGV). Arch Virol 2012, 157:1559–1564.View ArticlePubMed
              24. Hyatt AD, Gould A, Zupanovic Z, Cunningham AA, Hengstberger S, Whittington RJ, Kattenbelt J, Coupar BE: Comparative studies of piscine and amphibian iridoviruses. Arch Virol 2000, 145:301–331.View ArticlePubMed
              25. He J, Lu L, Deng M, He H, Weng S, Wang XH, Zhou SY, Long QX, Wang XZ, Chan SM: Sequence analysis of the complete genome of an iridovirus isolated from the tiger frog. Virology 2002, 292:185–197.View ArticlePubMed
              26. Granoff A, Came P, Breeze D: Viruses and renal carcinoma of Rana pipiens. Virology 1966, 29:133–148.View ArticlePubMed
              27. Puri B, Nelson WM, Henchal EA, Hoke CH, Eckels KH, Dubois DR, Porter KR, Hayes CG: Molecular analysis of dengue virus attenuation after serial passage in primary dog kidney cells. J Gen Virol 1997, 78:2287–2291.PubMed
              28. Huang Y, Huang X, Liu H, Gong J, Ouyang Z, Cui H, Cao J, Zhao Y, Wang X, Jiang Y, Qin Q: Complete sequence determination of a novel reptile iridovirus isolated from soft-shelled turtle and evolutionary analysis of Iridoviridae. BMC Genomics 2009, 10:224.View ArticlePubMed CentralPubMed
              29. Boyle K, Arps L, Traktman P: Biochemical and genetic analysis of the vaccinia virus D5 protein. Multimerization-dependent APTase activity is required to support viral DNA replication. J Virol 2007, 81:844–89.View ArticlePubMed CentralPubMed
              30. Striepen B, Soldati D, Garcia-Reguet N, Dubremetz JF, Roos D: Targeting of soluble proteins to the rhoptries and micronemes in Toxoplasma gondii . Mol Biochem Parasitol 2001, 113:45–53.View ArticlePubMed
              31. Jancovich JK, Davidson EW, Parameswaran N, Mao J, Chinchar VG, Collins JP, Jacobs BL, Storfer A: Evidence for emergence of an amphibian iridoviral disease because of human-enhanced spread. Mol Ecol 2005, 14:213–224.View ArticlePubMed
              32. Gray MJ, Miller DL, Hoverman JT: Ecology and pathology of amphibian ranaviruses. Dis Aquat Organ 2009, 87:243–266.View ArticlePubMed
              33. Mao J, Hedrick RP, Chinchar VG: Molecular characterization, sequence analysis, and taxonomic position of newly isolated fish iridoviruses. Virology 1997, 229:212–220.View ArticlePubMed
              34. Davis C, Field D, Metzgar D, Saiz R, Morin P: Numerous length polymorphisms at short tandem repeats in human cytomegalovirus. J Virol 1999, 73:6265–6270.PubMed CentralPubMed
              35. Barr JN, Whelan SPJ, Wertz GW: cis -acting signals involved in termination of vesicular stomatitis mRNA synthesis include the conserved AUAC and the U7 signal for polyadenylation. J Virol 1997, 71:8718–8725.PubMed CentralPubMed
              36. Yamada N, Tanihara K, Takada A, Yorihuzi T, Tsutsumi M, Shimomura H, Tsuji T, Date T: Genetic organization and diversity of the 3′ non-coding region of the hepatitis C virus genome. Virology 1996, 223:255–261.View ArticlePubMed
              37. Gosner KL: A simplified table for staging anuran embryos and larvae with notes on identification. Herpetologica 1960, 16:183–190.
              38. Echaubard P, Little K, Pauli B, Lesbarrères D: Context-dependent effects of ranaviral infection on Northern Leopard frog life history traits. PLoS One 2010, 5:e13723.View ArticlePubMed CentralPubMed
              39. Gehan EA: A generalized wilcoxon test for comparing arbitrarily singly-censored samples. Biometrika 1965, 52:203–223.View ArticlePubMed
              40. Leung KM, Elashoff RM, Afifi AA: Censoring issues in survival analysis. Annu Rev Public Health 1997, 18:83–104.View ArticlePubMed

              Copyright

              © Morrison et al.; licensee BioMed Central Ltd. 2014

              This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://​creativecommons.​org/​licenses/​by/​2.​0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated.