Open Access

Molecular characterization of avian reovirus isolates in Tunisia

  • Ymene Hellal Kort1,
  • Hager Bourogâa1,
  • Latifa Gribaa1,
  • Daniel Scott-Algara2 and
  • Abdeljelil Ghram1Email author
Virology Journal201310:12

DOI: 10.1186/1743-422X-10-12

Received: 5 March 2012

Accepted: 10 December 2012

Published: 5 January 2013

Abstract

Background

Genotype analyses of avian reoviruses isolated from organ samples collected from chickens with suspicious clinical symptoms, between 1997–2008, was based on sequences for both σC and σB genes and aligned with those published in the Genbank, making it possible to carry out studies of molecular classification and relationships.

Methods

The full length of the known variable protein σC and part of the σB encoding genes, were amplified with RT-PCR, using conserved primers. PCR products were sequenced and the sequences were analyzed and aligned with avian reovirus sequences from the Genbank database.

Results

The sequences of σC-encoding genes of all the isolated strains indicated their close relationship with the American, Chinese and Indian strains. Taking the American strain S1133 as a reference, the two Tunisian isolates 97.1 and 97.2 showed some nucleotide substitutions. For isolate 97.1, the substitution was silent whereas for strain 97.2 the mutation was at the first position of the corresponding codon and induced the substitution of the amino acid encoded. For the σB-encoding gene, the sequences of the Tunisian strains showed mutations at positions two or three of the corresponding codons, inducing substitutions of amino acids at these positions. The phylogenic trees based on σC and σB encoding genes indicated closer relationship between Tunisian, American and Taiwanese isolates of genotype I.

Conclusion

Our study describes the genotype of avian reoviruses that are not yet well characterized genetically. The characterization and classification of these viruses might be significant for understanding the epidemiology of malabsorption syndrome and viral arthritis, and improving our knowledge of the genotype of strains circulating in Tunisian flocks. Furthermore, the study of their variable pathogenicity could be extremely important in the choice of the appropriate vaccine strain to control disease.

Keywords

Avian reoviruses Malabsorption syndrome Arthritis σC gene σB gene Genotyping

Background

Avian reovirus (ARV) pathogens are found worldwide [13] and their molecular characterization, using PCR and nucleotide sequence analysis, have been described [46]. Yet, only a limited number of genomic sequences belonging mainly to the S- class, has been published. These sequences have characterized strains isolated from USA, Taiwan, Germany, Netherlands, Australia, Japan and China [7, 8]. Recently, σC protein sequences of some Indian strains were submitted to the Genbank.

Particles of ARV present two layers of capsid and 10 segments of double-stranded RNA [9]. Genomic segments can be separated on polyacrylamide gel electrophoresis into three different classes, based on size, named L (large), M (medium) and S (small). They encode for at least 8 structural and four non-structural proteins [10, 11]. Amongst the S-class segments of ARV, the segment S1 contains three open reading frames that are translated into P10, P17 and σC proteins [10, 11]. The protein P10 induces cell-cell fusion [12, 13] while P17 causes cellular protein translation shutoff and cell cycle arrest [14, 15]. The σC protein plays a role for virus attachment [16] and as apoptosis inducer [17]. It has been demonstrated that cell entry of avian reovirus follows a caveolin-1-mediated and dynamin-2-dependent endocytic pathways that require activation of p38 MAPK and Src signaling pathways [18]. It has also been suggested that it represents the target for type-specific neutralizing antibodies. The σB protein, encoded by the S3 gene [10, 19], carries group-specific neutralizing epitopes [20]. Recently, the ARV σA protein, encoded by the S2 gene [16], has been identified as a double-stranded RNA binding protein that may be involved in interferon resistance [21]. Another viral protein, σNS encoded by the S4 gene, has been reported as having a single-stranded RNA binding activity [22, 23].

This paper reports the analyses of the σC and part of the σB encoding genes along with the nucleotide sequences of 15 ARV isolates, identified over a 12-year period. To the best of our knowledge, this is the first report regarding the genotypic classification of ARV in Tunisia and in Africa. Because ARV are important poultry pathogens, causing arthritis, chronic respiratory disease and malabsorption syndrome, which result in considerable economic losses to the poultry industry [24, 25], better understanding their pathogenicity is economically important.

Methods

Being the major laboratory doing diagnostic and research for poultry diseases in Tunisia, samples from different flocks and regions were sent to the laboratory, by private and governmental veterinarians, for the diagnostic of major avian diseases. Fifteen ARV isolates were identified from chickens with viral arthritis, malabsorption syndrome or other suspected symptoms. The flocks were located in governments in the north (Bizerte, Ben Arous and Nabeul), the center (Sousse, Monastir and Mahdia) and the south (Sfax) of the country. ARV were propagated in specific pathogen-free (SPF) embryonnated chicken eggs, followed in cultures of primary chicken embryo fibroblast (CEF) or liver (CEL) cells [7]. The virus was detected when strong cytopathic effects (CPE) were observed after 3 to 5 subcultures; virus stocks were subsequently prepared in 75 cm2 flasks. Once 70-80% CPE were developed, cell cultures were frozen and thawed 3 times, then clarified with low centrifugation at 3000rpm for 20min. Supernatants were then conserved in aliquots at −80°C for later use. The vaccine strain (Nobilis S1133) was propagated in CEF cells and treated as described above. Viral RNA was extracted from supernatants using Trizol (Gibco Brl) as per the procedural modification described by Lee et al. [26]. Briefly, 1ml of Trizol was incubated with 300 μl of clarified supernatant for 5min, at room temperature. RNA was then isolated with chloroform (Sigma-Aldrich, France) and precipitated with isopropan-alcohol (Sigma-Aldrich, France) overnight. Total RNA was used as a template for RT-PCR reactions; non infected-cells and Rnase free water were used as negative controls.

Primers

Primers used for RT-PCR reactions (Table 1) were selected according to the sequences of S1 and S3 segments from available ARV sequences [4, 19, 27].
Table 1

RT-PCR primer sequences and expected PCR products

Designation

Sequence (5’-3’)

Gene

Locationa

PCR products (bp)

S1C

ATTGAATTCTCTCTGTTATCTAACCTTG

σC

446-472

738

S1D

AAGGAATTCGTTGAGAACAGAAGTAGG

σC

1183–1157

 

S1E

TCTGAATTCATCCGCAGCGAAGAGAGGTG

σC

630–658

342

S1F

AGTGAATTCAGTATCGCCGTGCGCAG

σB

971–943

 

S1G

CCTGAATTCGTGACTGACTTAACGAAC

 

910–936

720

S1I

ACGAATTCTTTCATTAGACATGGACC

 

1130–1156

520

S1H

TAAGAATTCCCAGTACGGCGCCACA

 

1629–1603

 

P1

TAACATCTAGCTATTTG

 

67–83

627

P2

CAAGCATTACAGGGCCAGC

 

720-738

 

a Location according to Yin et al.[19] and Liu et al. [27, 28].

Reverse transcription (RT), PCR and double Nested PCR (N-PCR)

A double N-PCR amplified the full length of the σC encoding gene. For the RT reactions, RNA was denatured in the presence of S1C or S1G forward primers (50pmol) and 1 μl RNasin (Promega) in a total volume of 11 μl, for 10 min, and rapidly cooled on ice. Subsequently, 9 μl RT mixture, containing 4 μl 5X first strand buffer (Invitrogen), 2 μl DTT and 2 μl dNTP (10 mM)) were added to each sample. After 2min incubation at 42°C, 1 μl superscript reverse transcriptase (Invitrogen) was added to each tube. The RT was carried out at 42°C for 50 min. The cDNA amplification was performed in 10 μl volume, containing 1,5 mM MgCl2, 1X PCR buffer (Invitrogen), 2,5U Taq DNA Polymerase (Invitrogen), 0,5 μM of each primer (S1C and S1D, S1G and S1H) and 5 μl of sample from the RT reaction. PCR reactions were subjected to 35 cycles (denaturation for 1 min at 94°C, annealing for 1 min at 55°C, extension for 2 min at 70°C) and one final extension cycle at 70°C for 10 min for the amplification of the whole σC gene. For the N-PCR, 5 μl of 1/10 or 1/100 of each RT-PCR product was amplified using primer sets (S1E and S1F, S1I and S1H) with the same components as for the PCR reaction. Samples were subjected to 35 cycles (45s denaturation at 94°C, 1min annealing at 55°C and 1min extension at 70°C) with a one final extension at 70°C for 7 min.

For the σB gene, samples were treated as described above. RT was performed using P1 primer and samples were subjects to 35 cycles (denaturation for 5 min at 94°C, annealing for 30 s at 50°C and extension for 70s at 70°C) with a one final extension for 7 min at 70°C.

Analysis of amplified products

After completion of the PCR reactions, 10μl of reaction mixtures were loaded onto a 2% agarose gel for 1 hour in TAE buffer (90 mM Tris–HCl, 90 mM acetic acid, 2 mM EDTA, pH 8,3), containing 5 μl/ml ethidium bromide, for electrophoresis and subsequent visualization with ultraviolet transilluminator. A DNA ladder of 100 bp was run as a size marker.

Sequencing analysis

PCR products were used for direct sequencing using forward and reverse primers to obtain the full length of σC and part of σB encoding genes. Sequencing was done three times using PCR products of the same isolate to avoid cross contamination. The ABI Prism Big Dye Terminator Cycle Sequencing Reaction kit (Applied Biosystems, Foster City, CA) was used and electrophoreses were run on polyacrylamide gel POP 7 in a four-capillary Applied Biosystem Genetic Analyser. Nucleotide sequences were aligned for comparison using “Clustal W” from Bio-Edit Sequence Alignment Editor [29, 30]. The sequences were deposited in the Genbank database (see Table 2 for the accession numbers of the nucleotide sequences).
Table 2

Virus used in this study and sequences submitted to Genbank by us and others

Isolate

Symptomsa

Origin

Yearb

Genbank accession numberl

 
    

σC

σB

S1133

V.A.c

USA

1973

AF330703

U20642

2408

Mal.S.d

USA

1983

AF204945

AF208038

1733

Mal.S.

USA

1983

AF004857

AF004856

138

V.A.

USA

UNf

AF218359

AF059721

176

V.A.

USA

UN

AF218358

AF059720

42563-4

R.S.Se

USA

2005

DQ872801.1

N.A.

GA41565

R.S.S.

USA

2005

DQ872799.1

N.A.

GA41560

R.S.S.

USA

2005

DQ872798.1

N.A.

GA 40973

RS.S

USA

2005

DQ872797.1

N.A.

MS46523-1

R.S.S.

USA

2005

ABJ09661.1

N.A.

GA40963

R.S.S.

USA

2005

ABJ09657.1

N.A.

V.A.Vac

Vaccineg

USA

2006

EF122837

N.A.

AVS-B

R.S.S.

USA

2005

YP004226527

YP004226529

JR1

N.Ah

England

UN

EF122836.1

N.A.

TU399

V.A.

Tunisia

1998

HM751135

HM751120

TU430

V.A.

Tunisia

1998

HM751137

HM751122

TU429

Mal.S.

Tunisia

1998

HM751136

HM751121

TU435

V.A.

Tunisia

1998

HM751138

HM751123

TU96

V.A.

Tunisia

1999

HM751139

HM751124

TU97.1

V.A.

Tunisia

1999

HM751140

HM751125

TU97.2

V.A

Tunisia

1999

HM751141

HM751126

TU119

Unclear i

Tunisia

1999

HM751142

HM751127

TU420

Unclear

Tunisia

2000

HM751143

HM751128

TU87

Unclear

Tunisia

2001

HM751144

HM751129

TU5

Mal.S.

Tunisia

2002

HM751145

HM751130

TU71B1

Unclear

Tunisia

2002

HM751146

HM751131

TU105B6

Mal.S.

Tunisia

2002

HM751147

HM751132

TU360

Mal.S.

Tunisia

2004

HM751148

HM751133

TU1390

Mal.S.

Tunisia

2008

HM751149

HM751134

NLI1296M

Mal.S

Netherlands

1996

AF354230.1

N.A.

NLI0298M

Mal.S

Netherlands

1998

AF354229.1

N.A.

NLA1396T

V.A.

Netherlands

1996

AF354228.1

N.A.

99G

Unclear

China

1999

N.A.

DQ415659

T-98

V.A.

China

2006

ABK51295.1

ABK32526.1

C-98

V.A.

China

2006

ABK51292.1

ABK32523.1

G-98

V.A.

China

2006

ABG43119.1

ABK32524.1

HB06

V.A.

China

2008

ACB11346.1

N.A.

OS161

Mal.S.

Japan

1970

AF204946

AF301471

Fahey and Crawley

R.D.k

Canada

1954

ABI97289.1

N.A.

GEL13a98M

Mal.S

Germany

1998

AF354226.1

N.A.

GEL13b98M

Mal.S

Germany

1998

AF354227.1

N.A.

GEL12 98M

Mal.S

Germany

1998

AF354225.1

N.A.

GEL06 97M

Mal.S

Germany

1997

AF354224.1

N.A.

GEL05 97M

Mal.S

Germany

1997

AF354223.1

N.A.

GEL03 97T

V.A.

Germany

1997

AF354222.1

N.A.

GEL01 96T

V.A.

Germany

1997

AF354221.1

N.A.

GEI09 97M

Mal.S

Germany

1997

AF354220.1

N.A.

GEI1097M

Mal.S

Germany

1997

AF354219.1

N.A.

K5

N.A.

India

2008

EU681261.1

N.A.

820

N.A.

India

2008

EU681260.1

N.A.

MKA

N.A.

India

2008

EU681259.1

N.A.

MS-4

N.A.

India

2008

EU681258.1

N.A.

1884

N.A.

India

2008

EU681257.1

N.A.

6-10

N.A

India

2008

EU681256.1

N.A.

VA-1is

V.A

India

1983

EU681254

N.A

VA-1

Vaccine

India

2008

EU681255.1

N.A.

Bareilly son-1

N.A.

India

2008

HM015906.1

N.A.

Bareilly

N.A.

India

2008

FJ949087.1

N.A.

T6

R.D

Taiwan

1970

AF204948

AF208036

750505

V.A.

Taiwan

1986

AF204950

AF208035

919

Normal

Taiwan

1992

AF204949

AF208034

601G

V.A.

Taiwan

1992

AF297217

AY008384

601SI

VA.

Taiwan

1992

AF204947

AF208037

R2/TW

V.A.

Taiwan

1992

AF297213

AF301472

918

Mal.S.

Taiwan

1992

AF297215

AF301473

916

Mal.S.

Taiwan

1992

AF297214

AY008383

1017-1

Mal.S.

Taiwan

1992

AF297216

AF301474

a: Symptoms observed in infected chickens; b: year of isolation of the corresponding strain; c: viral arthritis; d: malabsorption syndrome; e: Runting-stunning syndrome; f: year of isolation not known; g: sequences of vaccines derived from pathogenic strains S1133 or VA-1is; h: data not available; i: chicken's symptoms not described; j: apparent healthy chickens; k: Respiratory disease; l: Accession Numbers submitted by us or according to Shapouri et al. [4]; Kant et al. [7]; Shmulevitz et al. [31]; Liu et al. [27, 28]; Zhang et al. [32]; Guo et al. [33].

Phylogenic analysis

The full length of the σC and only part of the σB gene sequences were translated using the Bio-Edit program. The phylogenetic tree, for either epidemiological or phylogenic relationship studies, was constructed using Splits Tree version 4.10 Software with the Neighbour-Joining (NJ) method and bootstrap analysis (n=1000), to determine the best fitting tree for each gene [34].

Results

Fifteen Tunisian ARV were isolated (Table 2) in SPF eggs, CEF and/or CEL cell cultures. S1133 vaccine strain, used as a control, was propagated in CEF cultures. Aliquots of clarified freeze-thawed cell supernatants (4 or 5 passages) were used for RNA extraction. Using primer pairs of S1C-S1D, S1E-S1F, S1G-S1H, S1I-S1H for the σC gene and P1-P2 for the σB gene, RNA extracts from all ARV isolates as well as the S1133 strain was transcribed into cDNA and amplified, producing fragments with expected sizes of 738, 342, 720, 500 and 672 bp, respectively. PCR products from S1133 strain and the Tunisian isolates were obtained, indicating that primer regions were conserved in our strains. RNA extracted from non-infected cells and Rnase-free water were used as negative controls and no DNA amplification was observed, indicating that the amplified viral DNA was specific and did not originate from contamination.

Sequence analyses and phylogenic study

To gather information about the genetic classification of the Tunisian isolates, different sequences of σC and σB encoded genes, from pathogenic and vaccine strains were analysed. ARV sequences are labelled as submitted by our laboratory or by others (Table 2) [4, 7, 27, 28, 3133].

Alignment of nucleotides of the σC encoded gene of all identified strains showed a close relationship with the American S1133 and the English JR1 pathogenic strains [33] (Table 2). Analyses of the nucleotide sequences revealed that the Tunisian strains showed the same sequences as the strain S1133, except for the 97.1 and 97.2 isolates. The first one showed a substitution of Guanine with Adenine at the position 354. This mutation was observed for all Chinese, Japanese and Indian strains (pathogenic and vaccine ones) and the only isolate from Canada. However, six of all American (2048, 1733, 138, 176, GA41560, MS42563-1), seven of all Taiwanese (T6, 70505, 919, 601G, 601SI, R2/TW, 916) and one of two Australian (SOM-4) pathogenic strains showed the same mutation. Moreover, the 97.1 had the same sequence as the only English pathogenic strain JR1, except that the later shows a substitution of Guanine with Thymine at the position 927. Multi-alignment of deduced amino acid (AA) sequences revealed that the mutations at positions 354 and 927 were synonyms; thus no differences were found in the AA sequences between 97.1, S1133 and JR1 strains (Figure 1a). For the second strain 97.2, a substitution of Adenine with Guanine at position 355 of the σC gene was observed. This mutation was at the first position of the corresponding codon and induced the substitution of the amino acid encoded (Figure 1a). Same mutation was likewise detected for the German strain GEL13a98M and the two American strains MS42563-1 and 42563–4. Nevertheless, at this position, three of German (GEL0597M, GEL0397T, GEL0196T) and Dutch (NLA1396, NLI098M, NLI196) strains and two Taiwanese strains (918, 1017–1) showed one Cytosine. The two American strains GA40963 and GA41565, however, showed one Thymine at this position.
https://static-content.springer.com/image/art%3A10.1186%2F1743-422X-10-12/MediaObjects/12985_2012_Article_2044_Fig1_HTML.jpg
Figure 1

Multiple sequence alignment of σC (326 AA) (a) and part of σB proteins (b) (residue 67 to 153) of ARV. The predicted AA sequences of σC and part of σB proteins of 15 Tunisian ARV isolates (TU339, TU429, TU430, TU435, TU96, TU97.1, TU97.2, TU119, TU420, TU87, TU5, TU71B1, TU105B6, TU360 and TU1390) were aligned and compared to previously published sequences using 'Clustal W' from Bio-Edit Sequence Alignment Editor [27, 29]. Sequencing was done three times using PCR products of the same isolate to avoid cross contamination. AAs are numbered up the sequences residues. AAs identical to the S1133 pathogenic strain sequence are indicated by dot. Genbank accession numbers of the strains, either determined in this study or submitted by others, are cited in Table 2.

Using S1133 as a reference strain, alignment of nucleotide sequences of the σB encoded gene, showed some substitutions. The first one, located at the position 308, was observed only for TU430 and TU360 isolates. The second substitution located at position 438, was observed for strains TU429 and TU430 which were isolated in 1998, for TU96 and TU119, isolated in 1999 and for TU360, collected in 2004. Lastly, three substitutions were observed at positions 467, 521 and 656 for all Tunisian strains. Multi-alignment of these strains with the most published ones indicated that the sequences of their σB encoded gene are closely related to the Chinese 99G strain, which shows the same nucleotide sequence as the three isolates (TU429, TU96, TU119). Deduced AA sequences demonstrated that all the observed mutations are non-synonymous and imply substitutions of the corresponding AA (Figure 1b).

Phylogenic comparison of genotype clustering based on nucleotide sequences of the σC gene of the Tunisian isolates with published one, showed that they are closely related to each other and can be classified in cluster I with all Indian and Chinese strains as well as those isolated from England, Japan and Canada. They remain different from Australian and Dutch isolates, found only in the clusters V and VI, respectively. The Taiwanese isolates are more dispersed and evolved in at least 4 clusters. The isolates from Germany and America are the most dispersed ones and grouped in 5 different clusters and only one American strain 138 is placed in cluster II (Table 2, Figure 2a) [7, 8, 27].
https://static-content.springer.com/image/art%3A10.1186%2F1743-422X-10-12/MediaObjects/12985_2012_Article_2044_Fig2_HTML.jpg
Figure 2

Phylogenic trees of the σC (a) and part of the σB (b) genes of Tunisian ARV strains. The trees were generated on the base of nucleotides sequences using splits tree phylogenic software (version 4.10) with distance-based neighbour-joining (NJ). The reliability of the trees was assessed by bootstrap analysis with 1.000 replications; only bootstrap values of > 90% are shown. The length of the horizontal lines is proportional to the minimum number of nucleotide differences required to join nodes. The vertical lines are spacing branches and labels. The scale bar is proportional to the phylogenic distance (Table 2).

For the σB gene sequences, the phylogenic tree showed that the Tunisian strains are relatively closer to each other and can be classified in the same cluster I with the only Japanese strain OS161, all Chinese and four Taiwanese strains. The remainder Taiwanese strains are classified in cluster II and III, respectively. However, the American strains are dispersed in clusters I and III (Table 2, Figure 2b).

Discussion

ARV pathogenicity is very heterogeneous and ARV strains are associated with disease conditions such as viral arthritis (VA), tenosynovitis and Malabsorption Syndrome (MAS). They are also isolated from chickens without any clinical signs [35]. Although the relationship between reovirus and tenosynovitis has been established, a causative role is less clear in MAS [36]. The characterization and the classification of ARV might be important for the epidemiology of MAS and VA for the choice of the appropriate vaccine in farms with ARV problems. Although ARV infections still cause problems in poultry, the only available ARV sequences are for strains from the USA, Canada, Taiwan, Australia, the Netherlands, Germany, Japan, England and China. Recently, σC encoded gene sequences from Indian isolates became available in Genbank [7, 8] (Table 2).

Genotyping of ARV using σC encoded gene revealed at least 6 different genotypes [27], but correlations between genotypes, pathogenic characteristics and serotype classification have not been well established yet. A phylogenic study using the σC encoded gene indicated that, despite the close relationship with the first USA isolates belonging to clusters I and II, those recently isolated from chickens with Runting-Stuning Syndrome (RSS) showed dispersion and were classified in the 3 different clusters III, IV and VI (Table 2, Figure 2b). They remain quite different from Australian and Dutch strains, classified in the clusters V and VI, respectively. The first strains isolated from Taiwan were classified in cluster I, whereas the more recent ones were dispersed between the 3 clusters II, III, and V. Furthermore, the German strains isolated during the last two years are much more dispersed and classified into 5 clusters. Finally, the trypsin-resistant strain JR1 is classified in the cluster I [8, 27, 33].

Molecular characterization of the σC sequences of all Tunisian ARV, isolated from different field conditions over a twelve years period and compared to several published strains, allowed their classification in one cluster. However, no correlation could be established between the σC gene sequences and the disease conditions in the field. ARV were also isolated from apparently healthy chickens, making their classification in a true lineage difficult as stated by Kant et al. [7].

The σC-encoding gene has evolved into six clusters, while the other S-class genes have diverged into two to four clusters [27]. It displayed features of the highest level of sequence divergence and rapid evolution. Therefore, this gene could be used as a genetic marker for the classification of ARV isolates [27, 28]. Such classification in clusters is independent of determination of the 5' end, the 3' end or the whole ORF of the σC gene. Furthermore, sequencing of a representative part of this gene seems to be sufficient [7].

The major part of σC gene sequences of the Tunisian isolates was closely related to the very well-known American strain S1133. Only nucleotide sequences of the 97.1 and 97.2 strains showed mutations at the positions 354 and 355, respectively. A relationship between the 97.1 and JR1 strains is possible; however, data about the σB gene sequence of the later is not yet published for a possible gene comparison.

Analyses of the whole σB-encoding gene were performed to allow rapid detection of ARV infections with different Tunisian isolates. The constructed Phylogenic trees showed in previous studies that the gene evolves into 2–3 lineages [8, 27]. Analyses of the published sequences demonstrated that it evolves into 3 clusters, results obtained when using sequences of the whole gene or the representative sequence used in our work. Recently, we performed a restriction fragment length polymorphism (RFLP) with two restriction enzymes that cut in two sites among those containing mutations on our amplicons (data no shown). PCR/RFLP can be a procedure used for rapid characterization and differentiation of Tunisian ARV isolates.

Mutations do exist in the σB gene sequences of Tunisian strains, allowing their classification into 4 groups: a first group containing the TU430 and TU360 isolates; a second one with the TU429, TU96 and TU119 isolates; a third group containing the TU339, TU87, TU5, TU420, TU105B6, TU1390, TU71B1, TU435 and TU97.1 isolates and the fourth group with only the TU97.2 isolate. The substitution at position 467 was observed for all ARV with respect to the S1133 strain.

Sigma B protein was described as a high variable protein and possesses group-specific neutralizing epitopes [37]. Alignment analysis of amino acids of part of the σB protein showed that only the substitution at position 171 is silent, whereas all other mutations at positions 308, 438, 467, 521 and 656 are non-synonymous and induced substitution of the corresponding translated AA (Figure 1b). These mutations were also observed for the Chinese isolate 99G and indicated a possible relationship between the Tunisian and the Chinese ARVs. Unfortunately, the σC gene sequence of the 99G isolate is not available for comparison. For the Taiwanese strains, the majority of nucleotide substitutions were silent because they occur at the third position of the codons [27].

The σC protein, located on the surface of the outer layer capsid, induces neutralizing antibody production and is the determinant for ARV serotypes [16]. In previous studies, ARV strains were differentiated by virus neutralization assays [38]. Serological classification of ARV strains has not been successful because of high cross-reactivity of the neutralizing antibodies [33]. Nowadays, genotypic classification of ARV strains is performed using RT-PCR in combination with phylogenic analysis or other molecular techniques, such as RFLP [7, 26]. All phylogenic studies have classified ARV isolates into various groups and lineages; however, meta-analytically, there were no identical patterns. Such results suggested that different ARV genome segments may evolve in independent manner [27]. It is puzzling that no correlation was found between genotypes, serotypes and pathotypes, given detectable genetic differences of different ARV strains [7]. Divergences between genotypes, serotypes and pathogenicity suggested the involvement of multiple genes and proteins in serologic and pathogenic determination [33]. It may also result from high mutation rate of viral RNA and the possible reassortment between 2 strains co-infecting the same host [27, 39]. Geographic characteristic conditions could facilitate exchanges between segmented genomes within small numbers of viral strains, which would result in less genetic variation within a region [33].

Vaccination against reovirus infections generally involves a live S1133 vaccine followed by an inactivated vaccine containing strains 1733 and/or 2408, knowing to be related to tenosynovitis and stunting syndrome pathologic conditions and belonging to the same subtype [40, 41]. Although chickens were vaccinated, ARV pathogens still persist in Tunisian poultry. Serotyping studies are therefore needed to further elucidate the antigenic characteristics of these isolates and adapt the vaccination program.

Conclusion

In the present study, we characterize genetically avian reovirus Tunisian strains isolated from commercial chickens reared in different geographic areas, during a 12 year period. The classification of ARV could be realized using the σC gene, the most variable known gene but other gene studies may provide additional information. It was not possible, however, to correlate the genotype of isolated strains with neither a specific pathologic conditions nor a geographic or temporal parameter. Although the vaccination against ARV is used in farms, the pathogens still persist in Tunisian poultry flocks. Serotyping studies are underway to characterize the antigenic proprieties of these isolates, which will help adapting the vaccination program.

Abbreviations

AA: 

Amino acid

ARV: 

Avian reoviruses

SPF: 

Specific pathogen free

CEF: 

Chicken embryo fibroblast

CELC: 

Chicken embryo liver cells

CPE: 

Cytopathic effect

ARV: 

Avian reovirus

RT: 

Reverse transcription

N-PCR: 

Nested PCR

RSS: 

Runting-Stuning Syndrome

MAS: 

Malabsorption Syndrome

RFLP: 

Restriction fragment length polymorphism.

Declarations

Acknowledgement

This work was fully supported by a grant from the Tunisian Ministry of Higher Education and Scientific Research (Project LR00SP07).

Authors’ Affiliations

(1)
Laboratory of Epidemiology and Veterinary Microbiology, Institut Pasteur de Tunis, University of Tunis - El Manar
(2)
Unité de Régulation des Infections Rétrovirales, Institut Pasteur

References

  1. Ni Y, Kemp MC: A comparative study of avian reovirus pathogenicity: virus spread and replication and induction of lesions. Avian Dis. 1994, 39: 554-566.View Article
  2. Xie Z, Fadl AA, Girshick T, Khan MI: Amplification of avian reovirus RNA using the reverse transcriptase-polymerase chain reaction. Avian Dis. 1997, 41: 654-660. 10.2307/1592157.PubMedView Article
  3. Van de Zande S, Kuhn EM: Central nervous system signs in chickens caused by a new avian reovirus strain: a pathogenesis study. Vet Microbiol. 2007, 120: 42-49. 10.1016/j.vetmic.2006.10.024.PubMedView Article
  4. Shapouri MRS, Kane M, Letarte M, Bergeron J, Arella M, Silim A: Cloning, sequencing and expression of the S1 gene of avian reovirus. J Gen Virol. 1995, 76: 1515-1520. 10.1099/0022-1317-76-6-1515.PubMedView Article
  5. Liu HJ, Giambrone JJ: Molecular characterization of avian reoviruses using nested PCR and nucleotide sequence analysis. J Virol Methods. 1997, 65: 159-167. 10.1016/S0166-0934(97)02199-X.PubMedView Article
  6. Liu HJ, Giambrone JJ, Nielsen BL: Amplification, Cloning and Sequencing of the σC-encoded gene of avian reovirus. J Virol Methods. 1997, 63: 203-208. 10.1016/S0166-0934(96)02129-5.PubMedView Article
  7. Kant A, Blak F, Born L: Classification of Dutch and German avian reoviruses by sequencing the σC proteins. Vet Res. 2003, 34: 203-212. 10.1051/vetres:2002067.PubMedView Article
  8. Banyai K, Dandar E, Dorsey KM, Mato T, Palya V: The genomic constellation of a novel avian orthoreovirus strain associated with runting-stunting syndrome in broilers. Virus Genes. 2011, 42: 82-89. 10.1007/s11262-010-0550-z.PubMedView Article
  9. Spandidos DA, Graham AF: Physical and chemical characterization of an avian reovirus. J Virol. 1976, 19: 968-976.PubMedPubMed Central
  10. Varela R, Benavente J: Protein coding assignment of avian reovirus strain S1133. J Virol. 1994, 68: 6775-6777.PubMedPubMed Central
  11. Bodelon G, Labrada L, Martinez-Costas J: Modification of late membrane permeability in avian reovirus infected cells. J Biol Chem. 2002, 277: 17789-17796. 10.1074/jbc.M202018200.PubMedView Article
  12. Salsman J, Top D, Boutilier J, Duncan R: Extensive syncytium formation mediated by the reovirus FAST proteins triggers apoptosis-induced membrane instability. J Virol. 2005, 79: 8090-8100. 10.1128/JVI.79.13.8090-8100.2005.PubMedPubMed CentralView Article
  13. Liu HJ, Lin PY, Wang LR, Hsu HY, Liao MH, Shih WL: Activation of small GTPases RhoA and Rac1 is required for avian reovirus p10-induced syncytium formation. Mol Cells. 2008, 26: 396-403.PubMed
  14. Liu HJ, Lin PY, Lee JW, Hsu HY, Shih WL: Retardation of cell growth by avian reovirus p17 through the activation of p53 pathway. BBRC. 2005, 336: 709-715.PubMed
  15. Chulu JLC, Huang WR, Wang L, Shih WL, Liu HJ: Avian reovirus non-structural protein p17-induced G2/M cell cycle arrest and host cellular protein translation shutoff involve activation of p53-dependent pathways. J Virol. 2010, 84: 7683-7694. 10.1128/JVI.02604-09.PubMedPubMed CentralView Article
  16. Martinez-Costas J, Grande A, Varela R, Garcia-Martinez C, Benavente J: Protein architecture of avian reovirus S1133 and identification of cell attachment protein. J Virol. 1997, 71: 59-64.PubMedPubMed Central
  17. Shih WL, Hsu WH, Liao MH, Lee LH, Liu HJ: Avian reovirus σC protein induces apoptosis in cultured cells. Virology. 2004, 32: 65-77.View Article
  18. Huang WR, Wang YC, Chi PI, Wang CY, Lin CH, Liu HJ: Cell entry of avian reovirus follows a caveolin-1-mediated and dynamin-2-dependent endocytic pathway that requires activation of p38 mitogen-activated protein kinase (MAPK) and Src signalling pathways as well as microtubules and small GTPase Rab5 protein. J Biol Chem. 2011, 286: 30780-30794. 10.1074/jbc.M111.257154.PubMedPubMed CentralView Article
  19. Yin HS, Shieh HK, Lee LH: Characterization of the double stranded RNA genome segment S3 of avian reovirus. J Virol Methods. 1997, 67: 93-101. 10.1016/S0166-0934(97)00080-3.PubMedView Article
  20. Yang ZJ, Wang CY, Lee LH, Chuang KP, Lien YY, Yin HS, Tong DW, Xu XG, Liu HJ: Development of ELISA kits for antibodies against avian reovirus using the sigmaC and sigmaB proteins expressed in the methyltropic yeast Pichia pastoris. J Virol Methods. 2010, 163: 169-174. 10.1016/j.jviromet.2009.07.009.PubMedView Article
  21. Martinez-Costas J, Gonzalez-Lopez C, Vakharia VN, Benavente J: Possible involvement of the double-stranded RNA-Biding core protein σA in the resistance of avian reovirus to interferon. J Virol. 2000, 74: 1124-1131. 10.1128/JVI.74.3.1124-1131.2000.PubMedPubMed CentralView Article
  22. Chiu CJ, Lee LH: Cloning and nucleotide sequencing of the S4 genome segment of avian reovirus S1133. Arch Virol. 1997, 142: 2515-2520. 10.1007/s007050050258.PubMedView Article
  23. Huang PH, Li YJ, Su YP, Lee LH, Liu HJ: Epitope mapping and functional analysis of sigma A and sigma NS proteins of avian reovirus. Virology. 2005, 332: 584-595. 10.1016/j.virol.2004.12.005.PubMedView Article
  24. Kibenge FSB, Wilcox GE: Tenosynovitis in chickens. Vet Bull. 1983, 53: 431-443.
  25. Lin YH, Lee LH, Shih WL, Hu YC, Liu HJ: Baculovirus surface display of sigma C and sigma B proteins of avian reovirus and immunogenicity of the displayed proteins in a mouse model. Vaccine. 2008, 26: 6361-6367. 10.1016/j.vaccine.2008.09.008.PubMedView Article
  26. Lee LH, Shien JH, Shien HK: Detection of avian reovirus RNA and comparison of a portion of genome segment S3 by polymerase chain reaction and restriction enzyme fragment length polymorphism. Res Vet Sci. 1998, 65: 11-16. 10.1016/S0034-5288(98)90020-0.PubMedView Article
  27. Liu HJ, Lee LH, Hsu HW, Kio LC, Liao MH: Molecular evolution of avian reovirus: evidence for genetic diversity and reassortment of S-class genome segments and multiple cocirculating lineages. Virology. 2003, 314: 336-349. 10.1016/S0042-6822(03)00415-X.PubMedView Article
  28. Liu HJ, Lee LH, Shih WL, Li YJ, Su HY: Rapid characterization of avian reoviruses using phylogenetic analysis, reverse transcription-polymerase chain reaction and restriction enzyme fragment length polymorphism. Avian Pathol. 2004, 33: 171-180. 10.1080/03079450310001652130.PubMedView Article
  29. Hall TA: Bioedit: a user-friendly biological sequence alignment editor and analysis program for windows 95/98/NT. Nucl Acids Symp Ser. 1999, 41: 95-98.
  30. Bourogâa H, Miled K, Gribâa L, El Behi I, Ghram A: Characterization of new variants of avian infectious bronchitis virus in Tunisia. Avian Dis. 2009, 53: 426-433. 10.1637/8666-022609-Reg.1.PubMedView Article
  31. Shmulevitz M, Yameen Z, Dawe S, Shou J, OHara D, Holmes I, Duncan R: Sequential partially overlapping gene arrangement in the Tricistronic S1 genome segments of avian reovirus and Nelson Bay reovirus: Implications for Translation Initiation. J Virol. 2002, 76: 609-618. 10.1128/JVI.76.2.609-618.2002.PubMedPubMed CentralView Article
  32. Zhang Y, Liu M, Shuidong O, Hu QL, Guo DC, Chen HY, Han Z: Detection and identification of avian, duck, and goose reoviruses by RT-PCR: goose and duck reoviruses are part of the same genogroup in the genus Orthoreovirus. Arch Virol. 2006, 15: 1525-1538.View Article
  33. Guo K, Dormitoria T, Ou SC, Giambrone J: Detection and differentiation of avian reovirus using SYBR-green I-based two-step real-time reverse transcription PCR with melting curve analysis. Avian Dis. 2012, 56: 369-376. 10.1637/9692-022211-Reg.1.PubMedView Article
  34. Huson DH, Bryant D: Application of phylogenetic networks in evolutionary studies. Mol Biol Evol. 2006, 23: 254-267.PubMedView Article
  35. Robertson MD, Wilcox GE: Avian reovirus. Vet Bull. 1986, 56: 155-174.
  36. Van der Heide L: Viral arthritis/Tenosynovitis. Avian Pathol. 1977, 6: 71-84.View Article
  37. Wickramasinghe R, Meanger J, Enriquez CE, Wilcox GE: Avian reovirus proteins associated with neutralization of the virus infectivity. Virology. 1993, 194: 688-696. 10.1006/viro.1993.1309.PubMedView Article
  38. Wood GW, Nicholas RAJ, Hebert CN, Thornton DH: Serological comparisons of avian reoviruses. J Comp Pathol. 1980, 90: 29-38. 10.1016/0021-9975(80)90025-0.PubMedView Article
  39. Rekik MR, Silim A, Bernier G: Serological and pathogenic characterization of avian reoviruses isolated in Quebec. Avian Pathol. 1991, 20: 607-617. 10.1080/03079459108418800.PubMedView Article
  40. Van der Heide L, Kalbac M, Brustolon M: Development of an attenuated apathogenic reovirus vaccine against viral arthritis/tenosynovitis. Avian Dis. 1983, 27: 698-706. 10.2307/1590312.PubMedView Article
  41. Giambrone JJ, Solano W: Serologic comparison of avian reovirus isolates using Virus Neutralization and an Enzyme-Linked Immunosorbent Assay. Avian Dis. 1988, 6: 678-680.View Article

Copyright

© Hellal Kort et al; licensee BioMed Central Ltd. 2013

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://​creativecommons.​org/​licenses/​by/​2.​0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Advertisement