Complete genome sequencing and analysis of six enterovirus 71 strains with different clinical phenotypes

  • Hong-ling Wen1Email author,

    Affiliated with

    • Lu-ying Si1Email author,

      Affiliated with

      • Xiao-jing Yuan1,

        Affiliated with

        • Shu-bin Hao2,

          Affiliated with

          • Feng Gao3,

            Affiliated with

            • Fu-lu Chu1,

              Affiliated with

              • Cheng-xi Sun1 and

                Affiliated with

                • Zhi-yu Wang1Email author

                  Affiliated with

                  Virology Journal201310:115

                  DOI: 10.1186/1743-422X-10-115

                  Received: 14 June 2012

                  Accepted: 2 April 2013

                  Published: 11 April 2013

                  Abstract

                  Background

                  Hand, foot and mouth diseases (HFMD) caused by enterovirus 71(EV71) presents a broad spectrum of clinical manifestations ranging from mild febrile disease to fatal neurolocal disease. However, the mechanism of virulence is unknown.

                  Methods

                  We isolated 6 strains of EV71 from HFMD patients with or without neurological symptoms, and sequenced the whole genomes of the viruses to reveal the virulence factors of EV71.

                  Results

                  Phylogenetic tree based on VP1 region showed that all six strains clustered into C4a of C4 sub-genotype. In the complete polypeptide, 298 positions were found to be variable in all strains, and three of these positions (ValP814/IleP814 in VP1, ValP1148/IleP1148 in 3A and Ala P1728/Cys P1728/Val P1728 in 3C) were conserved among the strains with neurovirulence, but variable in strains without neurovirulence. In the 5-UTR region, it showed that the first 10 nucleotides were mostly conserved, however from the 11th nucleotide, nucleotide insertions and deletions were quite common. The secondary structure prediction of 5-UTR sequences showed that two of three strains without neurovirulence (SDLY11 and SDLY48) were almost the same, and all strains with neurovirulence (SDLY96, SDLY107 and SDLY153) were different from each other. SDLY107 (a fatal strain) was found different from other strains on four positions (CP241/TP241, AP571/TP571, CP579/TP579 in 5-UTR and TP7335/CP7335 in 3-UTR).

                  Conclusions

                  The three positions (ValP814/IleP814 in VP1, ValP1148/IleP1148 in 3A and Ala P1728/Cys P1728/Val P1728 in 3C), were different between two phenotypes. These suggested that the three positions might be potential virulent positions. And the three varied positions were also found to be conserved in strains with neurovirulence, and variable in strains without neurovirulence. These might reveal that the conservation of two of the three positions or the three together were specific for the strains with neurovirulence. Varation of secondary structure of 5-UTR, might be correlated to the changes of viral virulence. SDLY107 (a fatal strain) was found different from other strains on four positions, these positions might be related with death.

                  Keywords

                  Enterovirus 71 Virulent determinant Hand, foot and mouth disease

                  Background

                  Enterovirus 71 (EV71) belongs to the Enterovirus genus of the family Picornaviridae. It is one of the pathogens that are associated with hand, foot and mouth disease (HFMD). In most cases, EV71 infections are generally mild. However, this virus has also been implicated to cause severe neurological manifestations including aseptic meningitis, polio-like paresis and possibly fatal encephalitis [1].

                  Since 1969, when EV71 was first isolated in California, USA [2], EV71 associated outbreaks have been reported worldwide [310]. In recent years, it has gained more attention as there is an upward trend in the prevalence of EV71 in Asia [11]. EV71 infection is a serious threat to the health of infants and young children; therefore, it is necessary to understand the mechanism of central nervous system involvement. Zheng et al. reported nucleotide differences in 5-UTR between strains isolated from patients with and without neurological symptom, and proposed that such variation may be correlated with different clinical presentations [12]. Shih-Cheng Chang reported that a significant amino acid change was observed in more than one of high virulent strains [13]. Melchers et al. suggested that point mutations in 3-UTR can result in a lethal phenotype [14]. All these points were located in different regions of the genome, therefore, it is necessary to search for potential points associated with neurovirulence in complete genome.

                  Results

                  Virus identification and segmented amplification

                  All the six strains were proved to be EV71 by RT-PCR (Figure 1), and were amplified with the nine pairs of overlapping primes (Figure 2).
                  http://static-content.springer.com/image/art%3A10.1186%2F1743-422X-10-115/MediaObjects/12985_2012_2145_Fig1_HTML.jpg
                  Figure 1

                  Amplification of nucleic acid of SDLY107 by RT-PCR. M: DL2000 Marker, Lane 1: SDLY107, Lane 2: cell control, Lane 3: reagent control.

                  http://static-content.springer.com/image/art%3A10.1186%2F1743-422X-10-115/MediaObjects/12985_2012_2145_Fig2_HTML.jpg
                  Figure 2

                  Segmented amplification of complete sequence of SDLY107 strain by RT-PCR. M: DL2000 Marker, Lane 1:1 ~ 769 bp, Lane 2:719 ~ 1632 bp, Lane 3:1597 ~ 2568 bp, Lane 4:2532 ~ 3346 bp, Lane 5:3216 ~ 4134 bp, Lane 6:4043 ~ 5045 bp, Lane 7:4969 ~ 5877 bp, Lane 8:5799 ~ 6567 bp, Lane 9:6500 ~ 7405 bp.

                  Sequence analysis of the genomes

                  The sequences of the six strains were desposited in GenBank (GenBank accession number JX244182, JX244183, JX244184, JX244185, JX244186, JX244187). The genomes of strains SDLY11, SDLY48, SDLY96 and SDLY107 were all 7405 bp in length, whereas strains SDLY1 and SDLY153 were 7408 bp in length. All six strains had one ORF which encoded a polypeptide of 2193 amino acids.

                  Pair-wise nucleotide and amino acid sequence comparisons showed that the genetic variation among the six strains was limited. The nucleotide homology of the genomes was 95.5% ~ 99.7%. The amino acid homology of the polyproteins was 98.5% ~ 99.5%. The nucleotide homology of 5-UTR and 3-UTR were 97.2% ~ 99.6% and 95.3 ~ 100.0%, respectively. They shared 77.5%-99.0% nucleotide homology of the genomes with reference strains, and 98.6% to 89.6% at the amino acid level (Table 1).
                  Table 1

                  The nucleotide and amino acid homology of the six strains with reference strains(nucleotide/amino acid)

                   

                  SDLY1

                  SDLY11

                  SDLY48

                  SDLY96

                  SDLY107

                  SDLY153

                  U22521(A)

                  80.1/95.1

                  79.9/95.1

                  79.9/95.2

                  79.9/95.0

                  79.9/95.0

                  79.9/94.5

                  ETU22522(B)

                  81.9/95.9

                  81.9/95.8

                  81.9/95.9

                  81.9/95.8

                  82.0/95.7

                  81.7/95.2

                  DQ341361(C1)

                  82.3/96.3

                  82.2/96.2

                  82.5/96.4

                  82.3/96.2

                  82.3/96.2

                  82.1/95.6

                  AF119795(C2)

                  81.8/93.0

                  81.4/93.0

                  81.9/93.0

                  81.6/93.0

                  81.3/93.0

                  81.3/92.6

                  DQ341356(C3)

                  81.8/96.2

                  81.4/96.2

                  81.9/96.2

                  81.6/96.2

                  81.3/96.2

                  81.3/95.6

                  EU703813(C4a)

                  97.2/99.2

                  98.9/99.6

                  96.4/99.1

                  99.0/99.6

                  98.6/99.7

                  98.4/99.1

                  AF302996(C4b)

                  91.3/95.9

                  91.0/95.9

                  91.4/95.8

                  91.0/95.9

                  90.8/95.8

                  90.8/95.2

                  EU527983(C5)

                  82.1/96.4

                  82.0/96.4

                  82.3/96.3

                  82.1/96.4

                  82.1/96.5

                  82.1/95.9

                  U05876(CA16)

                  77.9/90.3

                  77.6/90.2

                  77.7/90.2

                  77.7/90.2

                  77.9/90.2

                  77.5/89.6

                  Phylogenetic analysis of the six strains and reference strains based on the nucleotide sequences of the complete VP1 region showed that all the six strains clustered in the C4a of C4 sub-genotype (Figure 3).
                  http://static-content.springer.com/image/art%3A10.1186%2F1743-422X-10-115/MediaObjects/12985_2012_2145_Fig3_HTML.jpg
                  Figure 3

                  Phylogenetic tree hylogenetic analysis based on EV71 VP1 nucleotide sequences (891 bp). ● strains isolated from patients without neurovirulence in this study, ▲ strains isolated from patients with neurological symptom in this study. The phylogenetic tree was drawn using the neighbor joining method. Bootstrap values are shown as percentages derived from 1000 samplings and the scale reflects the number of nucleotide substitution per site along the branches.

                  Analysis of polyprotein

                  The polyprotein consists in three regions [15]: P1 containing capsid proteins (VP ~ VP4), P2 and P3 containing non-structural proteins (2A, 2B, 2C, 3A, 3B, 3C and 3D) which are crucial for virus replication.

                  The complete genome sequence of 58 strains of EV71 were available in GenBank, but only 25 strains had information of clinical symptoms of the patients. 13 of the 25 strains isolated from patients with neurological symptom, and 12 of the strains were isolated from patients without neurological symptom. As we aimed to correlated sequences of defined clinical symptoms, we only analyzed the 25 genomes of EV71 strains from GenBank that had description of clinical symptoms and the 6 strains sequenced in this study (Table 2). In the complete polyprotein, 298 positions were found to be variable and three of these positions were statistical significant (Table 3). The three points were ValP814/IleP814 (Fishers Exact Test, P = 0.018, a =0.05), ValP1148/IleP1148 (Fishers Exact Test, P = 0.043, a =0.05) and Ala P1728/Cys P1728/Val P1728 (Fishers Exact Test, P = 0.018, a =0.05).
                  Table 2

                  Complete genome sequences of 31 strain used in this study

                  Strains with neurovirulence

                  Strains without neurovirulence

                  GenBank No.

                  Source

                  GenBank No.

                  Source

                  U22522

                  GenBank

                  EU753384

                  GenBank

                  AF316321

                  GenBank

                  HQ129932

                  GenBank

                  JQ514785

                  GenBank

                  AF304459

                  GenBank

                  EU753365

                  GenBank

                  GQ994989

                  GenBank

                  GQ231942

                  GenBank

                  FJ607334

                  GenBank

                  HQ828086

                  GenBank

                  GQ231936

                  GenBank

                  GU196833

                  GenBank

                  AF119796

                  GenBank

                  EU753397

                  GenBank

                  AF304457

                  GenBank

                  GQ994992

                  GenBank

                  GQ231935

                  GenBank

                  GQ231928

                  GenBank

                  GQ994990

                  GenBank

                  EU703814

                  GenBank

                  FJ606449

                  GenBank

                  FJ607337

                  GenBank

                  DQ341361

                  GenBank

                  EU703812

                  GenBank

                  SDLY1

                  Isolated in this study

                  SDLY96

                  Isolated in this study

                  SDLY11

                  Isolated in this study

                  SDLY107

                  Isolated in this study

                  SDLY48

                  Isolated in this study

                  SDLY153

                  Isolated in this study

                    
                  Table 3

                  Significant positions of polyprotein of 31 strains

                  Region

                  Position

                  Amino acid

                  Strains with neurovirulence

                  Strains without neurovirulence

                  VP1

                  814

                  Val/Ile(16/0)*

                  Val/Ile(10/5)

                  3A

                  1148

                  Val/Ile(16/0)

                  Val/Ile(11/4)

                  3C

                  1728

                  Ala/Cys/Val (16/0/0)

                  Ala/Cys/Val (10/1/4)

                  *Val/Ile(16/0): in all 16 strains with neurovirulence, 16 of them were ValP814 and none of them was IleP814

                  Analysis of 5-UTR

                  5-UTR sequences of 31 strains were aligned. It showed that the first 10 nucleotides were mostly conserved, however from the 11th nucleotide, nucleotide insertions and deletions were quite common. No position was found statistical significantly different between strains with and without neurological symptom. Whereas SDLY107 (a fatal strain) was found different from other strains on three positions (CP241/TP241, AP571/TP571, CP579/TP579), suggesting that these positions might be related to death.

                  5-UTR sequences of 6 strains isolated in our study were aligned by BioEdit 7.09 software (Figure 4), and no significantly difference was found.
                  http://static-content.springer.com/image/art%3A10.1186%2F1743-422X-10-115/MediaObjects/12985_2012_2145_Fig4_HTML.jpg
                  Figure 4

                  Sequence alignment of 5 -UTR sequences of 6 strains isolated in our study.

                  Phylogenetic analysis of 31 strains based on the nucleotide sequences of 5-UTR showed no definite regularity of these strains, revealing that there was no distinction on evolution between strains with different symptoms (Figure 5).
                  http://static-content.springer.com/image/art%3A10.1186%2F1743-422X-10-115/MediaObjects/12985_2012_2145_Fig5_HTML.jpg
                  Figure 5

                  Phylogenetic tree hylogenetic analysis based on 5 -UTR nucleotide sequences. ● strains without neurovirulence, ▲ strains with neurological symptom. The phylogenetic tree was drawn using the neighbor joining method. Bootstrap values are shown as percentages derived from 1000 samplings and the scale reflects the number of nucleotide substitution per site along the branches.

                  The 5-UTR of EV71 could be divided into two regions: the 5 terminal cloverleaf and the IRES element [16]. IRES initiated genome translation by a cap-independent mechanism mediated [17]. IRES includes five stem loop (domain I ~ V), all of these five domains are essential to viral RNA replication and translation. The secondary structure prediction of the complete 5-UTR sequences showed that two of three strains from patents without neurological symptom (SDLY11 and SDLY48) were almost the same, and all strains with neurovirulence (SDLY96, SDLY107 and SDLY153) were different from each other (Figure 6). In IRES element, domain III and II were relatively conservative regions, however, domainI, IV and V were marked variation. This information suggested that variety of secondary structure of 5-UTR, especially domainI,IV and V might influence virulence.
                  http://static-content.springer.com/image/art%3A10.1186%2F1743-422X-10-115/MediaObjects/12985_2012_2145_Fig6_HTML.jpg
                  Figure 6

                  The secondary structures of 5 -UTR. A: SDLY1, B: SDLY11, C: SDLY48, D: SDLY96, E: SDLY107, F: SDLY153.

                  Analysis of 3-UTR

                  The 3-UTR of EV71 was a highly conserved region and point mutations in the 3-UTR could result in a lethal phenotype [14]. Alignment of 3-UTR sequences of 31 strains by BioEdit 7.09 software did not reveal significant position associated with virulence. However, SDLY107 (a fatal strain) was found different from other strains on position TP7335/CP7335, suggesting that this position might be correlated to death.

                  Phylogenetic analysis of 31 strains based on the nucleotide sequences of 3-UTR (Figure 7) showed strains with different symptoms were mixed up, suggesting that there was no distinction on evolution between strains with or without neurological symptoms.
                  http://static-content.springer.com/image/art%3A10.1186%2F1743-422X-10-115/MediaObjects/12985_2012_2145_Fig7_HTML.jpg
                  Figure 7

                  Phylogenetic tree hylogenetic analysis based on 3 -UTR nucleotide sequences. ● strains without neurovirulence, ▲ strains with neurological symptom. The phylogenetic tree was drawn using the neighbor joining method. Bootstrap values are shown as percentages derived from 1000 samplings and the scale reflects the number of nucleotide substitution per site along the branches.

                  The secondary structure prediction of the complete 3-UTR sequences showed that except strain SDLY48, the other five strains were almost the same (Figure 8).
                  http://static-content.springer.com/image/art%3A10.1186%2F1743-422X-10-115/MediaObjects/12985_2012_2145_Fig8_HTML.jpg
                  Figure 8

                  The secondary structures of 3 -UTR. A: SDLY1, B: SDLY11, C: SDLY48, D: SDLY96, E: SDLY107, F: SDLY153.

                  Discussion

                  EV71 is one of the most virulent enteroviruses and can cause mortality in children [1]. Defining virulent positions on molecular level is considered as one of the most important aspects of disease prevention. In our study, complete genomes of six EV71 strains with different clinical phenotypes were sequenced and analyzed. Together with other strains isolated in Shandong in recent years, the six strains clustered into C4a of C4 sub-genotype [18].

                  At present, molecular neurovirulence determinant of EV71 remains unclear, though virulence factors of other enteroviruses have been reported. Nucleotide 480, 481 and 472 on 5-UTR of poliovirus were identified as neurovirulence determinants of poliovirus [1921]. Minetaro et al. reported that mutation of the EV71 standard strain BrCr in 5-UTR showed attenuated neurovirulence in the cynomolgus monkey model [22]. In this study, insertions and deletions were frequently found in 5-UTR region. Two of three EV71 strains (SDLY11 and SDLY48) from patients without neurovirulence had almost the same secondary structure of 5-UTR, and all strains with neurovirulence (SDLY96, SDLY107 and SDLY153) were different from each another. In IRES element, domain III and II were relatively conserved regions, however, domainI, IV and V are very variable. These suggest that variation of the secondary structure of the 5-UTR, especially domainI, IV and V might be correlated to the virulence. When aligned the strain isolated from a fatal patient (SDLY107) with other five strains, three position of 5-UTR (CP241/TP241, AP571/TP571, CP579/TP579) might be related to the virulence.Li et al. reported that four amino acids (GlyP710/GlnP710/ArgP710 and GluP729) in the DE and EF loop of VP1, one (LysP930) in the surface of protease 2A were potentially associated with EV71 virulence [23]. In our study, three positions, ValP814/IleP814 in VP1, ValP1148/IleP1148 in 3A and Ala P1728/Cys P1728/Val P1728 in 3C, were different between two phenotypes. These results suggest that three positions are potential virulent positions. The position 814 locates in C-terminal part of the VP1 protein which locates on the surface of the virus, mediates the initiation of infection by binding to receptors on the host membrane [24]. C-terminal part of the VP1 protein were supposed to be capable of eliciting neutralizing antibodies against EV71 [25]. Variations in VP1 region may influence the ability of the virus binding to host cell and eliciting neutralizing antibodies. Protein 3A plays a role in inhibiting cellular protein secretion and mediating presentation of membrane proteins during viral infection. Variations in 3A region may affect the process of viral infection. Protein 3C can cleave numerous factors and regulators that are associated with cellular DNA-dependant RNA polymerase I, II and III, and may be involved in the virus-induced blockage of host transcription. Variations in 3C region may affect activity of RNA polymerase and host cellular transcription. The three positions were conserved in strains with neurovirulence, and variable in strains without neurovirulence. These also reveales that the conservation of two of the three positions or the three together maybe specific for the strains with neurovirulence.

                  The 3-UTR is a highly conserved domain and mutations in the 3-UTR may cause change of phenotype. However, in our study, analysis of nucleotides of 3-UTR showed no virulence associated nucleotides.

                  To test our aforementioned findings, site-directed mutagenesis need to be performed on these positions in the future study, and infectious cDNA clones with different potential virulent positions need to be constructed and evaluated at ex vivo and in vitro.

                  Methods

                  Cells and viruses

                  EV71 strains SDLY1, SDLY11, SDLY48, and SDLY96 were isolated from stool samples of four patients without neurovirulence. SDLY107, SDLY153 were isolated from anal swabs samples of two patients. Among these strains, SDLY1, SDLY11 and SDLY48 were isolated from patients with mild symptoms. SDLY96 and SDLY153 were isolated from patients with neurological symptom, and SDLY107 was isolated from a fatal patient. All six patients were from Linyi City, Shandong Province, China. Human rhabdomyosarcoma (RD) cells were maintained in DMEM supplemented with 10% FBS. Viruses were propagated on RD cells to increase the titer for use in subsequent assays.

                  RNA extraction and virus identification

                  Total virus RNAs were extracted from EV71-infected cell culture supernatants using a RNA extraction kit (OMEGA) following the manufactures instructions. Virus types were identified by One-Step RT-PCR described previously [26].

                  Segmented amplification of the complete genomes

                  Nine overlapping clones covering the whole viral genome were obtained by RT-PCR (QIAGEN, OneStep RT-PCR Kit). RT-PCR amplifications were carried out with the primers in Table 4. RT-PCR products were purified using Gel Extraction Mini Kit (OMEGA) and were cloned to the pMD19-T plasmid (TaKaRa). The recombinant vectors were transformed into competent E. coli DH5α. Positive clones were sequenced by Biosune Biotechnology Co. Ltd.
                  Table 4

                  Primers used for amplifying the genome

                  NO.

                  Name of primer

                  Sequence

                  Amplification(bp)

                  1

                  P1+

                  TTAAAACAGCCTGTGGGTTGCACC

                  769 bp

                  P769-

                  GTGTAGACACTTGCGAACC

                  2

                  P719+

                  CTTGACCCTTAACACAGCTA

                  914 bp

                  P1632-

                  GCTCCTTGGTCGTAGTCTAG

                  3

                  P1597+

                  GTGCCTATTAGCCCACTAGAC

                  973 bp

                  P2568-

                  ACCTTGCCTGTATCCAGTCGA

                  4

                  P2532+

                  ACAGGTGAGCAGTCATCGACT

                  815 bp

                  P3346-

                  CTGTTGTCCAAATTTCCCAAGA

                  5

                  P3216+

                  GTGGATACCTCGCCCGATGC

                  919 bp

                  P4134-

                  CACTCTAACCCCTTAGCGGCGT

                  6

                  P4043+

                  CCATCTTAGGTATCCCTATCGC

                  1003 bp

                  P5045-

                  TTGTGTTGCCAATGGCGGACC

                  7

                  P4969+

                  GTCAGATACAGTGTGGATACG

                  909 bp

                  P5877-

                  CCACCAATGTGAATACCGACAA

                  8

                  P5799+

                  CAACTTTCCTACTAAAGCAGGAC

                  769 bp

                  P6567-

                  CCCACGGCTGATCCAGTTATCG

                  9

                  P6500+

                  TGGCTTTCGGACATTTGTATGA

                  906 bp

                  P7405-

                  GCTATTCTGGTTATAACAAATTTACC

                  Sequences analysis

                  The nucleotide sequences of six complete genomes and the derived amino acid sequences were analyzed by BioEdit 7.09 software. The genotype and subgenotype were determined by comparing sequences with reference strains from GenBank. The secondary structures of 5-UTR and 3-UTR were predicted by RNA structure 4.0 software. The phylogenetic tree was constructed using MEGA 4 software based on the nucleotide sequences of the complete VP1 region.

                  Ethics statement

                  This study was approved by the ethical committees of School of Public Health, Shandong University, Jinan, Shandong 250012, China (permit number 20080301). Written consents were obtained from all childrens parents involved in the study.

                  Abbreviations

                  EV71: 

                  Enterovirus 71

                  HFMD: 

                  Hand, foot and mouth diseases

                  RT-PCR: 

                  Reverse transcription-polymerase chain reaction

                  ORF: 

                  Open reading frame

                  IRES: 

                  Internal ribosome entry site

                  DMEM: 

                  Dulbecco’s modified Eagle’s medium

                  FBS: 

                  Supplemented with 10% fetal bovine serum.

                  Declarations

                  Acknowledgements

                  The research is supported by National Natural Science Foundation of China (30901265); Natural Science Foundation of Shandong Province (ZR2010CQ030); Innovation Foundation of Young Talent, School of Public Health, Shandong University(GGWS200801). We thank Shandong medical equipment quality supervision and inspection center, Shandong Linyi City people's hospital for support to conduct this study.

                  Authors’ Affiliations

                  (1)
                  The Key Laboratory of experimental teratology of Ministry of Education, Department of Virology, School of Public Health, Shandong University
                  (2)
                  Shandong Medical Equipment Quality Supervision And Inspection Center
                  (3)
                  Linyi People’s Hospital

                  References

                  1. Hagiwara A, Yoneyama T, Takami S, Hashimoto I: Genetic and phenotypic characteristics of enterovirus 71 isolates from patients with encephalitis and with hand, foot and mouth disease. Arch Virol 1984,79(3–4):273–283.PubMedView Article
                  2. Blomberg J, Lycke E, Ahlfors K, Johnsson T, Wolontis S, von Zeipel G: New enterovirus type associated with epidemic of aseptic meningitis and or hand, foot, and mouth disease. Lancet 1974,2(7872):112.PubMedView Article
                  3. Chumakov M, Voroshilova M, Shindarov L, Shindarov L, Lavrova I: Enterovirus 71 isolated from cases of epidemic poliomyelitis-like disease in Bulgaria. Arch Virol 1979,60(3–4):329–340.PubMedView Article
                  4. Ishimaru Y, Nakano S, Yamaoka K, Takami S: Outbreaks of hand, foot, and mouth disease by enterovirus 71. High incidence of complication disorders of central nervous system. Arch Dis Child 1980,55(8):583–588.PubMedView Article
                  5. Lan YC, Lin TH, Tsai JD, Yang YC, Peng CT: Molecular epidemiology of the 2005 enterovirus 71 outbreak in central Taiwan. Scand J Infect Dis 2011,43(5):345–349.View Article
                  6. Kim KH: Enterovirus 71 infection: An experience in Korea 2009. Korean J Pediatr 2010,53(5):616–622.PubMedView Article
                  7. Li Wei A, Benjamin KW K, Kwai Peng C, Chua LT, James L, Goh KT: Epidemiology and Control of Hand,Foot and Mouth Disease in Singapore, 2001–2007. Ann Acad Med Singapore 2009,38(2):106–112.
                  8. Schuffenecker I, Mirand A, Antona D, Henquell C, Chomel JJ: Epidemiology of human enterovirus 71 infections in France, 2000–2009. J Clin Virol 2011,50(1):50–56.PubMedView Article
                  9. McMinn P, Stratov I, Nagarajan L, Davis S: Neurological manifestations of enterovirus 71 infection in children during an outbreak of hand, foot, and mouth disease in Western Australia. Clin Infect Dis 2001,32(2):236–242.PubMedView Article
                  10. Chan LG, Parashar UD, Lye MS, Ong FG, Zaki SR: Deaths of children during an outbreak of hand, foot, and mouth disease in sarawak, malaysia: clinical and pathological characteristics of the disease. For the Outbreak Study Group. Clin Infect Dis 2000,31(3):678–683.PubMedView Article
                  11. Komatsu H, Shimizu Y, Takeuchi Y, Ishiko H, Takada H: Outbreak of severe neurologic involvement associated with enterovirus 71 infection. Pediatr Neuro 1999,20(1):17–23.View Article
                  12. Zheng ZM, He PJ, Caueffield D, Neumann M, Specter S: Enterovirus 71 isolated from China is serologically similar to the prototype E71 BrCr strain but differs in the 5′-noncoding region. J Med Virol 1995,47(2):161–167.PubMedView Article
                  13. Chang SC, Li WC, Chen GW, Tsao KC, Huang CG: Genetic characterization of enterovirus 71 isolated from patients with severe disease by comparative analysis of complete genomes. J Med Virol 2012,84(6):931–939.PubMedView Article
                  14. Melchers WJ, Hoenderop JG, Bruins Slot HJ, Pleij CW, Pilipenko EV: Kissing of the two predominant hairpin loops in the coxsackie B virus 3′untranslated region is the essential structural feature of the origin of replication required for negative-strand RNA synthesis. J Virol 1997,71(1):686–696.PubMed
                  15. Wimmer E, Hellen CU, Cao X: Genetics of poliovirus. Annu Rev Genet 1993, 27:353–436.PubMedView Article
                  16. Bedard KM, Semler BL: Regulation of picornavirus gene expression. Microbes Infect 2004,6(7):702–713.PubMedView Article
                  17. Pelletier J, Kaplan G, Racaniello VR, Sonenberg N: Cap-independent translation of poliovirus mRNA is conferred by sequence elements within the 5′noncoding region. Mol Cell Biol 1988,8(3):1103–1112.PubMed
                  18. Liu XL, Wang ZG, Yang TT, Yi T: Molecular epidemiology of human enterovirus 71 strains in Qingdao region, Shandong province, 2007–2009. Chin J Epidemiol 2011,32(4):382–384.
                  19. Evans DM, Dunn G, Minor PD, Schild GC, Cann AJ: Increased neurovirulence associated with a single nucleotide change in a noncoding region of the Sabin type 3 poliovaccine genome[J]. Nature 1985,314(6011):548–550.PubMedView Article
                  20. Guillot S, Otelea D, Delpeyroux F, Crainic R: Point mutations involved in the attenuation/neurovirulence alternation in type 1 and 2 oral polio vaccine strains detected by site-specific polymerase chain reaction. Vaccine 1994,12(6):503–507.PubMedView Article
                  21. Rezapkin GV, Fan L, Asher DM, Fibi MR, Dragunsky EM: Mutations in Sabin 2 strain of poliovirus and stability of attenuation phenotype. Virology 1999,258(1):152–160.PubMedView Article
                  22. Arita M, Shimizu H, Nagata N, Ami Y, Suzaki Y: Temperature-sensitive mutants of enterovirus 71 show attenuation in cynomolgus monkeys. J Gen Virol 2005,86(5):1391–1401.PubMedView Article
                  23. Li R, Zou Q, Chen L, Zhang H, Wang Y: Molecular Analysis of Virulent Determinants of Enterovirus 71. PLoS One 2011,6(10):e26237.PubMedView Article
                  24. Lin JY, Chen TC, Weng KF, Chang SC, Chen LL: Viral and host proteins involved in picornavirus life cycle. J Biomed Sci 2009,16(1):103.PubMedView Article
                  25. Foo DG, Alonso S, Phoon MC, Ramachandran NP, Chow VT: Identification of neutralizing linear epitopes from the VP1 capsid protein of Enterovirus 71 using synthetic peptides. Virus Res 2007,125(9):61–68.PubMedView Article
                  26. Guidelines for the prevention and treatment of HFMD. http://​www.​moh.​gov.​cn/​publicfiles/​business/​cmsresources/​wsb/​cmsrsdocument/​doc4510.​doc

                  Copyright

                  © Wen et al.; licensee BioMed Central Ltd. 2013

                  This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://​creativecommons.​org/​licenses/​by/​2.​0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

                  Advertisement