Genomic analysis of a newly isolated of Japanese encephalitis virus strain, CQ11-66, from a pediatric patient in China

  • Li-Juan Xu1, 2, 3, 4,

    Affiliated with

    • Ruixi Liu1, 2, 3, 4,

      Affiliated with

      • Sheng Ye5,

        Affiliated with

        • Hua Ling5 and

          Affiliated with

          • Chao-Min Zhu1Email author

            Affiliated with

            Virology Journal201310:101

            DOI: 10.1186/1743-422X-10-101

            Received: 24 July 2012

            Accepted: 22 March 2013

            Published: 1 April 2013

            Abstract

            Background

            Japanese encephalitis virus (JEV) is one of the major causative agents of viral encephalitis in East Asia, Southeast Asia and Australia. However, no clinical JEV strain has yet been isolated from JE patients in Chongqing, China. In this study, we report the genomic analysis of a new JEV strain, CQ11-66, isolated from a pediatric patient in Chongqing, China.

            Findings

            Virus isolation was carried out in BHK-21 cells. Nested PCR was used to detect and isolate the JEV strain, and computer analysis of phylogenetic relationships, nucleic acid homology studies and deduction of the amino acid sequence were conducted using ClustalX (1.8) and Mega5 software. The JEV strain CQ11-66 was isolated from patient cerebrospinal fluid. The sequenced genome of CQ11-66 was 10,863 nucleotides in length, whereas other strains, such as SX09S-01, contain 10,965 nucleotides. Sequence comparison of the CQ11-66 polyprotein open reading frame (ORF) with those of 21 other JEV strains revealed that the nucleotide sequence divergence ranged from 1.68% to 18.46%. Sequence analysis of the full-length CQ11-66 E gene sequence with those of 30 other JEV isolates also identified nucleotide divergence, ranging from 1.69% to 18.74%. Phylogenetic analyses indicated that the CQ11-66 strain belonged to genotype III.

            Conclusions

            JEV genotype III still circulates in Chongqing and it is therefore important for active surveillance of JEV genotype III to be conducted in the pediatric population.

            Keywords

            Japanese encephalitis virus Genomic analysis CQ11-66 strain

            Findings

            Japanese encephalitis virus (JEV) is the most important causes of epidemic encephalitis in Southeast Asia and Western Pacific regions, with an estimated 35,000 to 50,000 cases each year, and approximately 1-3 of every 1000 JEV infections resulting in severe disease [1]. JEV is a small, enveloped virus with a single-stranded, positive-sense RNA genome of approximately 11,000 nt. Its ORF is translated into a large polyprotein that includes three structural proteins (C, prM and E) and seven non-structural proteins (NS1, NS2A, NS2B, NS3, NS4A, NS4B and NS5) [2]. Since the first JEV isolate was reported in 1949, JE epidemics have occurred in China, and Chongqing is listed as the region of highest incidence. However, no clinical JEV strain has been isolated from human cerebrospinal fluid (CSF), serum or brain tissue of fatal cases in Chongqing; thus, the molecular characteristics and genetic diversity of clinical JEV strains remain unknown.

            In this study, acute serum and CSF specimens were collected from patients who were clinically diagnosed with Japanese encephalitis (JE) during July to October in 2011 and hospitalized in the Children’s Hospital of Chongqing Medical University. Serum specimens were diluted in minimal essential medium at a ratio of 1 to 5, pretreated with 100 U ml-1 penicillin and streptomycin and placed for at least four hours at 4°C. CSF specimens were incubated directly. A monolayer of BHK-21 cells was grown to 90% confluence and incubated with either CSF or diluted serum at 37°C. Once cytopathic effects (CPE) were observed in a culture, viruses were harvested from the culture medium by centrifugation at 10,000 rpm for 10 min. Viral RNA was extracted from the supernatant (140 μL) of infected BHK-21 cells cultures using the QIAamp® Viral RNA kit (QIAGEN; USA). RNA was reverse-transcribed using a random primer and amplified with a Go Tag® Hot Start Polymerase kit (Promega; USA). The full-length genome was amplified by polymerase chain reaction (PCR) with TaKaRa LA Taq polymerase (TaKaRa; China) using seven pairs of primers (Table 1). The PCR reaction conditions were as follows: 3 min of cDNA denaturation at 94°C, followed by 30 cycles of 94°C denaturation for 30 sec, 55°C primer annealing for 30 sec, and 72°C primer extension for 1 min. Amplified products were examined by agarose gel electrophoresis (1%), purified with a Takara MiniBEST Agarose Gel DNA Extraction Kit Ver 3.0 (TaKaRa; China) and sent to TaKaRa for commercial sequencing. The full-length genome of the strains was compiled using the SeqMan program in the Lasergene software package (DNASTAR). The percentage similarities between aligned nucleotide or amino acid sequences were calculated using MEGA 5 software. Phylogenetic analysis was performed by the neighbor-joining (NJ) method using MEGA5 software. For the previously published JEV strain sequences, the host background, year of isolation, geographic origin and GenBank accession number are listed in Table 2. Multiple sequence alignments and the NJ tree were generated by ClustalX (1.8). The genomic sequence of 21 strains and the E gene sequence of 30 strains were employed in the generation of the phylogenetic trees. The bootstrap probabilities of each node were calculated using 100 replicates.
            Table 1

            Primers for nucleic acid amplification assays

            Name

            5 -3

            Length

            PrimerF1

            AGTATCGTTGAGAAGAATCG

            20

            PrimerF2

            TATGCTTTCCTGGCGGCGGTAC

            22

            PrimerF3

            GAAGGGGAGACAAGCAGATCAA

            22

            PrimerF4

            CTGCAAGAGAGGAAAAAGACCA

            22

            PrimerF5

            GGAGGGGCAGAGTAGGCAGAAA

            22

            PrimerF6

            CCGTTGGCTCGTGGAGAAAGGA

            22

            PrimerF7

            TCAGCGGAGATGACTGTGTCGT

            22

            PrimerR1

            CCTTCATTTCCTCCTCTTTTGT

            22

            PrimerR2

            TGAACGGCTTTTCCTATGGAGT

            22

            PrimerR3

            CAAACATCAATCCAACTGCCGA

            22

            PrimerR4

            AGTCCATTGGGCATGTGTATGT

            22

            PrimerR5

            TCTGCATGAGCATCGGTTCTTC

            22

            PrimerR6

            AAATGGTTAGAGCAGAAGGGAA

            22

            PrimerR7

            TCTTCCTCACCACCAGCTACAT

            22

            Table 2

            Bankground of Japanese encephalitis virus strains used in this study

            Strain

            Source

            Genotype

            Geographical location

            Year

            GenBank accession no./reference

                 

            ORF

            E gene

            Beijing-1

            Human

            III

            China

            1948

            L48961

            L48961

            CH1392

            Mosquito

            III

            Taiwan

            1990

            AF254452

            U44960.1

            FU

            Human

            II

            Australia

            1995

            AF217620

            L43565.1

            GP78

            Human

            III

            India

            1978

            AF075723

            AF075723

            SA14-14-2

            Vaccin strain

            III

            China

            1954

            AF315119.1

            AF315119.1

            JaGAr01

            Mosquito

            III

            Japan

            1959

            AF069076

            AF069076

            WTP

            Mosquito

            II

            Malaysia

            1970

            HQ223286

            U70421

            K94P05

            Mosquito

            I

            Korea

            1994

            AF04555

            U34929

            JKT5441

            Mosquito

            II

            Indonesia

            1981

            AF045551

            U34929

            JKT6468

            Mosquito

            IV

            Indonesia

            1981

            AY184212

            U70407

            Ishikawa

            Mosquito

            I

            Japan

            1998

            AB051292

            AB051292

            Ling

            Human

            III

            Taiwan

            1965

            L78128

            L78128

            RP-9

            Mosquito

            III

            Taiwan

            1985

            AF014161

            AF014161

            47

            Human

            III

            China

            1950s

            AY243827

            AY243827

            SA14

            Mosquito

            III

            China

            1960

            U14163

            AY243850

            K87P39

            Mosquito

            III

            Korea

            1987

            AY585243

            AY585243

            P20778

            Human

            III

            India

            1958

            AF080251

            Z34096

            CH21955A

            Mosquito

            III

            Taiwan

            1994

            AF221500

            AF221500

            ML11

            Vaccine

            III

            Japan

            1981

            AY508812

            U70412

            jaOArS982

            Mosquito

            III

            Japan

            1982

            M18370

            M18370

            Nakayama

            Human

            III

            Japan

            1935

            EF571853

            AF112297

            JKT7003

            Mosquito

            IV

            Indonesia

            1981

             

            U70408

            Sagiyama

            Mosquito

            III

            Japan

            1957

             

            U70419

            Kamiyama

            Human

            III

            Japan

            1966

             

            AB379813

            K82P01

            Mosquito

            III

            Japan

            1982

             

            U34926

            826309

            Human

            III

            India

            1982

             

            Z34094

            ThCMAr6793

            Mosquito

            I

            Thaliand

            1993

             

            D45363

            JKT1724

            Mosquito

            III

            Indonesia

            1979

             

            U70404

            SH-53

            Mosquito

            I

            China

            2001

             

            AY555757

            PhAn1242

            Pig

            III

            Philippines

            1984

             

            U70417

            In total, only one cell culture incubated with a patient CSF sample, named CQ11-66, tested positive by PCR, and none of the cell cultures incubated with patient serum samples tested positive. The genome sequence of CQ11-66 was 10,863 nucleotides in length, with an open reading frame (ORF) (GenBank: KC183732) of 10,296 nt coding for a polyprotein. When comparing its ORF with that of 21 other JEV strains isolated from different geographic regions or periods, high levels of similarity were observed, with nucleotide divergence ranging from 1.68% to 18.46%, and amino acid divergence ranging from 0.32% to 4.89%. A comparison of the CQ11-66 polyprotein ORF with that of SA14-14-2, the attenuated JEV vaccine strain currently widely used in China, discovered a total of 201 nucleotide differences (1.96%) and 42 amino acid differences (1.23%).

            The nucleotide and amino acid sequences of the CQ11-66 strain E region were compared with those of other isolates available in GenBank. This analysis revealed that nucleotide divergence ranged from 1.62% to 18.74%, while deduced amino acid divergence ranged from 1.01% to 5.13%. Among these amino acid mutations, the E408 (Arg to Lys) variation was unique to CQ11-661. A comparison of the CQ11-66 strain E gene with that of SA14-14-2 also indicated 36 nucleotide changes, resulting in 15 amino acid changes: E76 (Thr to Met), E107 (Phe to Leu), E138 (Lys to Glu), E176 (Val to Thr), E177 (Ala to Thr), E209 (Lys to Arg), E227 (Ser to Pro), E244 (Gly to Glu), E264 (His to Gln), E279 (Met to Lys), E306 (Glu to Gly), E315 (Val to Ala), E408 (Arg to Lys), E416 (Asp to Gly) and E439 (Asp to Gly). On the basis of the ORF gene sequences of 22 JEV isolates and the E gene sequences of 31 JEV isolates, phylogenetic trees were constructed (shown in Figures 1 and 2). Both phylogenetic trees provided similar topology, and the analysis indicated that the CQ11-66 strain belonged to genotype III.
            http://static-content.springer.com/image/art%3A10.1186%2F1743-422X-10-101/MediaObjects/12985_2012_2106_Fig1_HTML.jpg
            Figure 1

            Phylogenetic tree constructed by the neighbor-joining method, based on the polyprotein ORFs of selected Japanese encephalitis virus strains. The CQ11-66 China 2011 human obtained in this study is shown in bold face.

            http://static-content.springer.com/image/art%3A10.1186%2F1743-422X-10-101/MediaObjects/12985_2012_2106_Fig2_HTML.jpg
            Figure 2

            Phylogenetic tree constructed by the neighbor-joining method, based on the envelope (E) protein gene of selected Japanese encephalitis virus strains. The CQ11-66 China 2011 human obtained in this study is shown in bold face.

            On the basis of 240 nucleotide of the C/prM gene, JEV strains were divided into five genotypes two decades ago [3, 4]. However, the functional significance of the prM genetic variations remains to be established, and genetic relationships based on short sequences (<300 nt) should be required to take into account the biological significance and may be considered with caution [5, 6]. Subsequently, the full-length E gene of JEV and its deduced protein sequence have been used as reliable phylogenetic markers, given that the E protein plays an important role in the JEV life cycle [7]. In China, many JEV strains belonging to genotype I and genotype III have been reported, and it was suggested by surveillance data that genotype I strains have been gradually replacing genotype III as the dominant strains in Asia. Due to limited sequence information regarding JEV isolates in Chongqing, the dominant genotype in one of the high-incidence regions in China remains unclear. In this study, phylogenetic analyses employing the ORF and E gene sequence of the CQ11-66 strain indicated it belonged to genotype III.

            The crystallographic structure of the E protein of the flavivirus tick-borne encephalitis virus revealed that the E protein consists of three domains. The difference in the E gene of JEV strains, particularly in domain III [8], may contribute to the diversity of neutralizing and antigenic properties [9]. Previous research has also indicated that mutations in domain III modulated virus binding and entry into host cells [10, 11]. In this study, comparison of the E gene of CQ11-66 strain with the vaccine strain SA14-14-2 revealed 15 amino acid substitutions. Among these variations, the Glu to Lys alteration at position 138 is consistent with previous observations that the E138 mutation is associated with attenuation of the JEV strain and inhibits viral spread from cell to cell [12]. Other groups have also demonstrated that mutations of residues E49, E138, E306 and E389 of the E protein reduce the efficiency of viral binding to heparan sulphate residues on target cells [13]. In our results, a substitution (Met to Lys) was observed at the position E279, which may increase virulence in mice [14].

            Genetic variation among JEV strains isolated from widely different time periods and geographical regions has been reported in many studies [13]. A previous study examining 46 JEV strains found that those from a much wider geographic region and at certain time period were similar, but that genetic variation was present among strains from diverse regions or from different time periods in the same region. These observations suggested JEV is continuously evolving [15]. Meanwhile, Yun et al. [16] reported that the E gene sequences of the 10 Korean JEV strains, despite differences in their geographic distributions and the maximum five-year time span, showed remarkable genetic stability. Such stability in the JEV genome was also observed in strains from China and Japan [17, 18]. In this study, phylogenetic analyses of the CQ11-66 ORF and the ORF of 21 other JEV strains isolated from several countries revealed the lowest nucleotide divergence and the lowest amino acid divergence with the JaGA01 strain. Meanwhile, phylogenetic analyses of its E gene and the E gene of 30 other JEV strains revealed the lowest nucleotide divergence and the lowest amino acid divergence with the JaGA01 strain.

            In conclusion, we have isolated a JEV strain from a JE patient in Chongqing, China. Molecular analysis of the nucleotide and amino acid sequences indicated that CQ11-66 belonged to genotype III, and comparison of the ORF sequence and the E gene sequence with other strains from different regions at different periods revealed high homology.

            Ethics statement

            The study was performed after consultation with the patients or their guardians and after the receipt of written consent. The study-related information was used anonymously. The Institutional Review Board of the Children’s hospital of Chongqing Medical University approved the research involving human materials.

            Declarations

            Acknowledgements

            We are grateful to Dr Yongjun Zhang from Fujian Center for Disease Control and Prevention for technical advice.

            Authors’ Affiliations

            (1)
            Department of Infectious diseases and Gastroenterology, Children’s Hospital of Chongqing Medical University
            (2)
            Ministry of Education Key Laboratory of Child Development and Disorders
            (3)
            Key Laboratory of Pediatrics in Chongqing,CSTC2009CA5002)
            (4)
            Chongqing International Science and Technology Cooperation Center for Child Development and Disorders
            (5)
            Chongqing Center for Disease Control and Prevention

            References

            1. Yun SI, Kim SY, Rice CM, Lee YM: Development and application of a reverse genetics system for Japanese encephalitis virus. J.Viro 2003, 77:6450–6465.View Article
            2. Lindenbach BD, Rice CM: Flaviviridae:the viruses and their eplication. In Fields Virology. 4th edition. Edited by: Knipe DM Howley PM. Philadelphia: Lippincott Willams and Wilkins; 2001:991–1041.
            3. Ali A, Igarashi A: Antigenic and genetic variation among Japanese encephalitis virus strains belong to genotype I. Microbio Immunol 1997, 41:241–252.
            4. Huong VT, Ha D, Deubel V: Genetic study of Japanese encephalitis viruses from Vietnam. AmJTrop Med Hyg 1993, 49:538–544.
            5. Ni H, Barret ADT: Nucleotide and deduced amino acid sequence of the structural protein genes of Japanese encephalitis viruses from different geographical location. J Gen Virol 1995, 76:401–407.PubMedView Article
            6. Westaway EG, Block J: Taxonomy and evolutionary relationships of flavivirus. pp. 147–173. Walling Ford: CAB International; 1997.
            7. Monath TP, Heinz FX: Flaviviruses,p.961–1034. In Fields virology. 3rd edition. Edited by: Fields BN, Knipe DM, Howley PM. Philadephia, Pa: Lip- pincott-Raven; 1996.
            8. Rey FA, Heinz FX, Mandl C, Kunz C, Harrison SC: The envelope glycoprotein from tick-borne encephalitis virus at 2 A resolution. Nature 1995, 375:291–298.PubMedView Article
            9. Gritsun TS, Holmes EC, Gould EA: Analysis of flavivirus envelope proteins reveals variable domains that reflect their antigenicity and may determine their pathogenesis. VirusRes 1995, 35:307–321.View Article
            10. Hung JJ, Hsieh MT, Young MJ, Kao CL, King CC, Chang W: An external loop region of domain III of denguevirus type 2 envelope protein is involved in serotype-specific binding to mosquito but not mammalian cells. J Virol 2004, 78:378–388.PubMedView Article
            11. Liu H, Chiou S-S, Chen W-J: Differential binding efficiency between the envelope protein of Japanese encephalitis virus variants and heparin sulfate on the cell surface. J Med Virol 2004, 72:618–624.PubMedView Article
            12. Zhao Z, Date T, Li Y, Kato T, Miyamoto M, Yasui K, Wakita T: Characterization of the E-138(Glu/Lys) mutation in Japanese encephalitis virus By using a stable, full-length, infectious cDNA clone. J Gen Virol 2005, 86:2209–2220.PubMedView Article
            13. Mangada MN M, Takegami T: Molecular characterization of the Japanese encephalitis virus representative immunotype strain JaGAr01. Virus Res 1999, 59:101±112.View Article
            14. Monath TP, Arroyo J, Levenbook I, Zhang ZX, Catalan J, Draper K, Guirakhoo F: Single mutation in the flavivirus envelope protein hinge region increases neurovirulence for mice and monkeys but decreases viscerotropism for monkeys: relevance to development and safety testing of live,attenuated vaccines. J Virol 2002, 76:1932–1943.PubMedView Article
            15. Williams DT, Wang LF, Daniels PW, Mackenzie JS: Molecular characterization of the first Australian isolate of Japanese encephalitis virus, the FU strain. J Gen Virol 2000, 81:2471–2480.PubMed
            16. Yun SM, Cho JE, Ju YR: Molecular epidemiology of Japanese encephalitis virus circulating in South Korea,1983–2005. Viro J 2010, 7:127.View Article
            17. Wang HY, Takasaki T, Fu SH, Sun XH, Zhang HL, Wang ZX, Hao ZY, Zhang JK, Tang Q, Kotaki A, Tajima S, Liang XF, Yang WZ, Kurane I, Liang GD: Molecular epidemio-logical analysis of Japanese encephalitis virus in China. J Gen Virol 2007, 88:885–894.PubMedView Article
            18. Nerome R, Tajima S, Takasaki T, Yoshida T, Kotaki A, Lim CK, Ito M, Sugiyama A, Yamauchi A, Yano T, Kameyama T, Morishita I, Kuwayama M, Ogawa T, Sahara K, Ikegaya A: Molecular epidemiological analyses of Japanese encephalitis virus isolates from swine in Japan from 2002 to 2004. J Gen Virol 2007, 88:2762–2768.PubMedView Article

            Copyright

            © Xu et al.; licensee BioMed Central Ltd. 2013

            This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://​creativecommons.​org/​licenses/​by/​2.​0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

            Advertisement